TALEN

TALEN1-smyhc1,smyhc2,smyhc3

ID

ZDB-TALEN-210902-1

Previous Names

None

Targets

smyhc1 (1)
smyhc2 (1)
smyhc3 (1)

Target Sequence 1

5' - TGAGGTCAACTCACCCTC - 3'

Target Sequence 2

5' - CTTAGTCTCATTGGGGATCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
stl582	smyhc1
stl584	smyhc1

Expression

Gene expression in Wild Types + TALEN1-smyhc1,smyhc2,smyhc3

No data available

Phenotype

Phenotype resulting from TALEN1-smyhc1,smyhc2,smyhc3

No data available

Phenotype of all Fish created by or utilizing TALEN1-smyhc1,smyhc2,smyhc3

Phenotype	Fish	Conditions	Figures
post-vent region kinked, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 4 from Whittle et al., 2020
slow muscle cell disorganized, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 6 from Whittle et al., 2020
muscle cell ab-f59 labeling absent, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 1 from Whittle et al., 2020
trunk kinked, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 4 from Whittle et al., 2020
vertebral column kinked, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 4 from Whittle et al., 2020
slow muscle cell Z disc ab1-actn labeling absent, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 6 from Whittle et al., 2020
whole organism decreased life span, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 3 from Whittle et al., 2020
whole organism dead, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 3 from Whittle et al., 2020
whole organism paralysed, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 2 from Whittle et al., 2020
slow muscle cell actin filament punctate, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 6 from Whittle et al., 2020
slow muscle cell shape, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 6 from Whittle et al., 2020
slow muscle cell Z disc absent, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 6 from Whittle et al., 2020
post-vent region curved dorsal, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 4 from Whittle et al., 2020
whole organism ab-f59 labeling absent, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 1 from Whittle et al., 2020
slow muscle cell Z disc ab1-actn labeling spatial pattern, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 6 from Whittle et al., 2020
motor behavior decreased process quality, abnormal	smyhc1^{stl582/stl582}	standard conditions	Figure 5 from Whittle et al., 2020
post-vent region kinked, abnormal	smyhc1^{stl584/stl584}	control	Figure 2 , Figure 7 from Whittle et al., 2020
slow muscle cell disorganized, abnormal	smyhc1^{stl584/stl584}	standard conditions	Figure 6 from Whittle et al., 2020
trunk kinked, abnormal	smyhc1^{stl584/stl584}	control	Figure 2 , Figure 7 from Whittle et al., 2020
trunk shape, ameliorated	smyhc1^{stl584/stl584}	chemical treatment: blebbistatin	Figure 7 from Whittle et al., 2020
somite decreased length, abnormal	smyhc1^{stl584/stl584}	standard conditions	Figure 6 from Whittle et al., 2020
post-vent region shape, ameliorated	smyhc1^{stl584/stl584}	chemical treatment: blebbistatin	Figure 7 from Whittle et al., 2020
myotome decreased length, abnormal	smyhc1^{stl584/stl584}	standard conditions	Figure 6 from Whittle et al., 2020
notochord kinked, abnormal	smyhc1^{stl584/stl584}	standard conditions	Figure 2 from Whittle et al., 2020
pericardium edematous, abnormal	smyhc1^{stl584/stl584}	chemical treatment: blebbistatin	Figure 7 from Whittle et al., 2020
slow muscle cell actin filament punctate, abnormal	smyhc1^{stl584/stl584}	standard conditions	Figure 6 from Whittle et al., 2020
slow muscle cell shape, abnormal	smyhc1^{stl584/stl584}	standard conditions	Figure 6 from Whittle et al., 2020
slow muscle cell Z disc ab1-actn labeling spatial pattern, abnormal	smyhc1^{stl584/stl584}	standard conditions	Figure 6 from Whittle et al., 2020
slow muscle cell Z disc disorganized, abnormal	smyhc1^{stl584/stl584}	standard conditions	Figure 6 from Whittle et al., 2020
post-vent region curved dorsal, abnormal	smyhc1^{stl584/stl584}	chemical treatment: blebbistatin	Figure 7 from Whittle et al., 2020
post-vent region kinked, abnormal	smyhc1^stl584/+	control	Figure 4 , Figure 7 from Whittle et al., 2020
slow muscle cell disorganized, abnormal	smyhc1^stl584/+	standard conditions	Figure 6 from Whittle et al., 2020
trunk kinked, abnormal	smyhc1^stl584/+	control	Figure 4 , Figure 7 from Whittle et al., 2020
trunk shape, ameliorated	smyhc1^stl584/+	chemical treatment: blebbistatin	Figure 7 from Whittle et al., 2020
post-vent region shape, ameliorated	smyhc1^stl584/+	chemical treatment: blebbistatin	Figure 7 from Whittle et al., 2020
vertebral column kinked, abnormal	smyhc1^stl584/+	standard conditions	Figure 4 from Whittle et al., 2020
myotome decreased length, abnormal	smyhc1^stl584/+	standard conditions	Figure 6 from Whittle et al., 2020
notochord kinked, abnormal	smyhc1^stl584/+	standard conditions	Figure 2 from Whittle et al., 2020
whole organism decreased life span, abnormal	smyhc1^stl584/+	standard conditions	Figure 3 from Whittle et al., 2020
pericardium edematous, abnormal	smyhc1^stl584/+	chemical treatment: blebbistatin	Figure 7 from Whittle et al., 2020
whole organism dead, abnormal	smyhc1^stl584/+	standard conditions	Figure 3 from Whittle et al., 2020
slow muscle cell actin filament punctate, abnormal	smyhc1^stl584/+	standard conditions	Figure 6 from Whittle et al., 2020
slow muscle cell shape, abnormal	smyhc1^stl584/+	standard conditions	Figure 6 from Whittle et al., 2020
post-vent region curved dorsal, abnormal	smyhc1^stl584/+	standard conditions	Figure 4 from Whittle et al., 2020
somite decreased length, abnormal	smyhc1^stl584/+	standard conditions	Figure 6 from Whittle et al., 2020
post-vent region curved dorsal, abnormal	smyhc1^stl584/+	chemical treatment: blebbistatin	Figure 7 from Whittle et al., 2020
motor behavior decreased process quality, abnormal	smyhc1^stl584/+	standard conditions	Figure 5 from Whittle et al., 2020
trunk kinked, abnormal	smyhc1^stl584/+; smyhc1^stl582/+	standard conditions	Figure 2 from Whittle et al., 2020
post-vent region kinked, abnormal	smyhc1^stl584/+; smyhc1^stl582/+	standard conditions	Figure 2 from Whittle et al., 2020
notochord kinked, abnormal	smyhc1^stl584/+; smyhc1^stl582/+	standard conditions	Figure 2 from Whittle et al., 2020

Citations