TALEN

TALEN1-twist1b

ID

ZDB-TALEN-190304-3

Name

TALEN1-twist1b

Previous Names

None

Target

twist1b (1)

Target Sequence 1

5' - TCAGCAACAGCGACGGAGAG - 3'

Target Sequence 2

5' - TCTTTTCCTTGCGCACCTTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
el570	twist1b

Expression

Gene expression in Wild Types + TALEN1-twist1b

No data available

Phenotype

Phenotype resulting from TALEN1-twist1b

No data available

Phenotype of all Fish created by or utilizing TALEN1-twist1b

Phenotype	Fish	Conditions	Figures
pharyngeal arch ectomesenchyme sox10 expression spatial pattern, abnormal	twist1a^el571/el571; twist1b^el570/el570	standard conditions	Fig. 2 from Teng et al., 2018
palatoquadrate cartilage decreased size, abnormal	twist1a^el571/el571; twist1b^el570/el570	standard conditions	Fig. 2 from Teng et al., 2018
palatoquadrate cartilage morphology, abnormal	twist1a^el571/el571; twist1b^el570/el570	standard conditions	Fig. 2 from Teng et al., 2018
hyosymplectic cartilage decreased size, abnormal	twist1a^el571/el571; twist1b^el570/el570	standard conditions	Fig. 2 from Teng et al., 2018
hyosymplectic cartilage morphology, abnormal	twist1a^el571/el571; twist1b^el570/el570	standard conditions	Fig. 2 from Teng et al., 2018
pharyngeal arch ectomesenchyme sox10 expression increased amount, abnormal	twist1a^el571/el571; twist1b^el570/el570	standard conditions	Fig. 2 from Teng et al., 2018
frontal bone bone growth increased occurrence, abnormal	twist1b^el570/el570; tcf12^el548/el548	standard conditions	Fig. 4 from Teng et al., 2018
frontal-parietal joint absent, abnormal	twist1b^el570/el570; tcf12^el548/el548	standard conditions	Fig. 1 from Teng et al., 2018
frontal-parietal joint morphology, abnormal	twist1b^el570/el570; tcf12^el548/el548	standard conditions	Fig. 1 from Teng et al., 2018
frontal bone fused with parietal bone, abnormal	twist1b^el570/el570; tcf12^el548/el548	standard conditions	Fig. 1 from Teng et al., 2018
parietal bone bone growth decreased occurrence, abnormal	twist1b^el570/el570; tcf12^el548/el548	standard conditions	Fig. 4 from Teng et al., 2018
parietal bone bone growth increased occurrence, abnormal	twist1b^el570/el570; tcf12^el548/el548	standard conditions	Fig. 4 from Teng et al., 2018
frontal-parietal joint grem1a expression decreased amount, abnormal	twist1b^el570/el570; tcf12^el548/el548	standard conditions	Fig. 7 from Teng et al., 2018
frontal-parietal joint mesenchyme absent, abnormal	twist1b^el570/el570; tcf12^el548/el548	standard conditions	Fig. 1 from Teng et al., 2018
frontal-parietal joint prrx1a expression decreased amount, abnormal	twist1b^el570/el570; tcf12^el548/el548	standard conditions	Fig. 7 from Teng et al., 2018
frontal bone morphology, abnormal	twist1b^el570/el570; tcf12^el548/el548	standard conditions	Fig. 4 from Teng et al., 2018
parietal bone morphology, abnormal	twist1b^el570/el570; tcf12^el548/el548	standard conditions	Fig. 4 from Teng et al., 2018
frontal-parietal joint prrx1a expression decreased distribution, abnormal	twist1b^el570/el570; tcf12^el548/el548	standard conditions	Fig. 7 from Teng et al., 2018
frontal-parietal joint grem1a expression decreased distribution, abnormal	twist1b^el570/el570; tcf12^el548/el548	standard conditions	Fig. 7 from Teng et al., 2018
frontal-parietal joint gli1 expression decreased distribution, abnormal	twist1b^el570/el570; tcf12^el548/el548	standard conditions	Fig. 7 from Teng et al., 2018
frontal bone bone growth decreased occurrence, abnormal	twist1b^el570/el570; tcf12^el548/el548	standard conditions	Fig. 4 from Teng et al., 2018
cranial vault decreased length, abnormal	twist1b^el570/el570; tcf12^el548/el548	standard conditions	Fig. 1 from Teng et al., 2018
frontal-parietal joint gli1 expression decreased amount, abnormal	twist1b^el570/el570; tcf12^el548/el548	standard conditions	Fig. 7 from Teng et al., 2018
frontal bone bone growth increased occurrence, abnormal	twist1b^el570/el570; tcf12^el548/el548; b1212Tg	standard conditions	Fig. 5 , Fig. 5-S1 from Teng et al., 2018
parietal bone bone growth increased occurrence, abnormal	twist1b^el570/el570; tcf12^el548/el548; b1212Tg	standard conditions	Fig. 5 , Fig. 5-S1 from Teng et al., 2018
frontal bone morphology, abnormal	twist1b^el570/el570; tcf12^el548/el548; b1212Tg	standard conditions	Fig. 5-S1 , Fig. 5-S2 from Teng et al., 2018
parietal bone morphology, abnormal	twist1b^el570/el570; tcf12^el548/el548; b1212Tg	standard conditions	Fig. 5-S1 , Fig. 5-S2 from Teng et al., 2018
parietal bone osteoblast proliferation increased occurrence, abnormal	twist1b^el570/el570; tcf12^el548/el548; b1212Tg	standard conditions	Fig. 5 from Teng et al., 2018
frontal bone osteoblast proliferation increased occurrence, abnormal	twist1b^el570/el570; tcf12^el548/el548; b1212Tg	standard conditions	Fig. 5 from Teng et al., 2018
palatoquadrate cartilage morphology, ameliorated	twist1a^el571/el571; twist1b^el570/el570; tcf12^el548/el548	standard conditions	Fig. 2 from Teng et al., 2018
hyosymplectic cartilage morphology, ameliorated	twist1a^el571/el571; twist1b^el570/el570; tcf12^el548/el548	standard conditions	Fig. 2 from Teng et al., 2018
pharyngeal arch ectomesenchyme sox10 expression spatial pattern, abnormal	twist1a^el571/el571; twist1b^el570/el570; tcf12^el548/el548	standard conditions	Fig. 2 from Teng et al., 2018
pharyngeal arch ectomesenchyme sox10 expression increased amount, abnormal	twist1a^el571/el571; twist1b^el570/el570; tcf12^el548/el548	standard conditions	Fig. 2 from Teng et al., 2018

Citations