TALEN

TALEN2-sox2

ID
ZDB-TALEN-180705-1
Name
TALEN2-sox2
Previous Names
None
Target
Target Sequence 1
5' - TGATGGAAACCGAGCTGAAGC - 3'
Target Sequence 2
5' - TCCCCGTGCCCCCGGTGTTGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
x50 sox2
Expression
Gene expression in Wild Types + TALEN2-sox2
No data available
Phenotype
Phenotype resulting from TALEN2-sox2
No data available
Phenotype of all Fish created by or utilizing TALEN2-sox2
Phenotype Fish Conditions Figures
otic placode pax2a expression decreased distribution, abnormal sox2x50/x50 (AB) standard conditions Fig. 3 with image from Gou et al., 2018
vagal ganglion 1 phox2a expression decreased distribution, abnormal sox2x50/x50 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
caudal fin morphology, abnormal sox2x50/x50 (AB) standard conditions Fig. 1 with image from Gou et al., 2018
vagal ganglion 2 phox2a expression decreased amount, abnormal sox2x50/x50 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
auditory receptor cell decreased amount, abnormal sox2x50/x50 (AB) standard conditions Fig. 2 with image from Gou et al., 2018
vagal ganglion 2 phox2a expression decreased distribution, abnormal sox2x50/x50 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
facial ganglion phox2a expression decreased distribution, abnormal sox2x50/x50 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
facial ganglion phox2a expression decreased amount, abnormal sox2x50/x50 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
glossopharyngeal ganglion phox2a expression decreased amount, abnormal sox2x50/x50 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
vagal ganglion 1 phox2a expression decreased amount, abnormal sox2x50/x50 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
vagal ganglion 1 phox2a expression decreased amount, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
vagal ganglion 1 phox2a expression spatial pattern, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
glossopharyngeal ganglion phox2a expression decreased distribution, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
epibranchial placode pax2a expression decreased amount, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
otic placode pax2a expression decreased distribution, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 3 with image from Gou et al., 2018
auditory receptor cell decreased amount, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 2 with image from Gou et al., 2018
vagal ganglion 1 phox2a expression decreased distribution, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
glossopharyngeal ganglion phox2a expression spatial pattern, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
vagal ganglion 2 phox2a expression decreased amount, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
statoacoustic (VIII) ganglion neuron decreased amount, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 2 with image from Gou et al., 2018
epibranchial placode pax2a expression spatial pattern, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
otic placode pax8 expression decreased distribution, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 3 with image from Gou et al., 2018
vagal ganglion 2 phox2a expression spatial pattern, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
epibranchial placode pax2a expression decreased distribution, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
vagal ganglion 2 phox2a expression decreased distribution, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
facial ganglion phox2a expression decreased distribution, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
facial ganglion phox2a expression decreased amount, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
glossopharyngeal ganglion phox2a expression decreased amount, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
Citations