TALEN

TALEN1-tlcd3ba

ID

ZDB-TALEN-180227-2

Name

TALEN1-tlcd3ba

Previous Names

TALEN1-fam57ba

Target

tlcd3ba (1)

Target Sequence 1

5' - TGGCATCCTCTGCTGG - 3'

Target Sequence 2

5' - TCCTCGATGATGTCTTTACAAGAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
wi720	tlcd3ba
zf3800	tlcd3ba

Expression

Gene expression in Wild Types + TALEN1-tlcd3ba

No data available

Phenotype

Phenotype resulting from TALEN1-tlcd3ba

No data available

Phenotype of all Fish created by or utilizing TALEN1-tlcd3ba

Phenotype	Fish	Conditions	Figures
whole organism increased velocity, abnormal	tlcd3ba^wi720/wi720	control	Fig. 3, Table 1 from McCammon et al., 2017
whole organism behavioural activity, ameliorated	tlcd3ba^wi720/wi720	chemical treatment: pentetrazol, chemical treatment: carbamazepine	Fig. S4 from McCammon et al., 2017
swimming behavior rate, exacerbated	tlcd3ba^wi720/wi720	chemical treatment: pentetrazol	Fig. 3 from McCammon et al., 2017
swimming behavior increased rate, abnormal	tlcd3ba^wi720/wi720	control	Fig. 3 from McCammon et al., 2017
whole organism velocity, ameliorated	tlcd3ba^wi720/wi720	chemical treatment: pentetrazol, chemical treatment: carbamazepine	Fig. S4 from McCammon et al., 2017
head increased length, abnormal	tlcd3ba^wi720/wi720	standard conditions	Fig. 5 from McCammon et al., 2017
whole organism behavioural activity, ameliorated	tlcd3ba^wi720/wi720	chemical treatment: pentetrazol, chemical treatment: valproic acid	Fig. S4 from McCammon et al., 2017
whole organism increased behavioural activity, exacerbated	tlcd3ba^wi720/wi720	chemical treatment: pentetrazol	Fig. 3 from McCammon et al., 2017
hindbrain increased width, abnormal	tlcd3ba^wi720/wi720	standard conditions	Fig. 5 from McCammon et al., 2017
swimming behavior rate, ameliorated	tlcd3ba^wi720/wi720	chemical treatment: pentetrazol, chemical treatment: valproic acid	Fig. S4 from McCammon et al., 2017
eye increased height, abnormal	tlcd3ba^wi720/wi720	standard conditions	Fig. 5 from McCammon et al., 2017
swimming behavior rate, ameliorated	tlcd3ba^wi720/wi720	chemical treatment: pentetrazol, chemical treatment: carbamazepine	Fig. S4 from McCammon et al., 2017
whole organism increased velocity, exacerbated	tlcd3ba^wi720/wi720	chemical treatment: pentetrazol	Fig. 3 from McCammon et al., 2017
whole organism increased behavioural activity, abnormal	tlcd3ba^wi720/wi720	control	Fig. 3, Table 1 from McCammon et al., 2017
head increased height, abnormal	tlcd3ba^wi720/wi720	standard conditions	Fig. 5 from McCammon et al., 2017
whole organism velocity, ameliorated	tlcd3ba^wi720/wi720	chemical treatment: pentetrazol, chemical treatment: valproic acid	Fig. S4 from McCammon et al., 2017
whole organism increased length, abnormal	tlcd3ba^wi720/wi720	standard conditions	Fig. 4 from McCammon et al., 2017
whole organism lipid increased amount, abnormal	tlcd3ba^wi720/wi720	standard conditions	Fig. 4 , Table 1 from McCammon et al., 2017
whole organism increased size, abnormal	tlcd3ba^wi720/wi720	standard conditions	Table 1 from McCammon et al., 2017
head increased size, abnormal	tlcd3ba^wi720/wi720	standard conditions	Table 1 from McCammon et al., 2017
forebrain increased width, abnormal	tlcd3ba^wi720/wi720	standard conditions	Fig. 5 from McCammon et al., 2017
eye increased width, abnormal	tlcd3ba^wi720/wi720	standard conditions	Fig. 5 from McCammon et al., 2017
eye increased distance eye, abnormal	tlcd3ba^wi720/wi720	standard conditions	Fig. 5 from McCammon et al., 2017
whole organism increased velocity, abnormal	doc2a^wi721/+; tlcd3ba^wi720/+	standard conditions	Fig. 3, Table 1 from McCammon et al., 2017
whole organism behavioural activity, ameliorated	doc2a^wi721/+; tlcd3ba^wi720/+	chemical treatment: pentetrazol, chemical treatment: carbamazepine	Fig. S4 from McCammon et al., 2017
swimming behavior rate, exacerbated	doc2a^wi721/+; tlcd3ba^wi720/+	chemical treatment: pentetrazol	Fig. 3 from McCammon et al., 2017
whole organism velocity, ameliorated	doc2a^wi721/+; tlcd3ba^wi720/+	chemical treatment: pentetrazol, chemical treatment: carbamazepine	Fig. S4 from McCammon et al., 2017
swimming behavior increased rate, abnormal	doc2a^wi721/+; tlcd3ba^wi720/+	control	Fig. 3 from McCammon et al., 2017
whole organism behavioural activity, ameliorated	doc2a^wi721/+; tlcd3ba^wi720/+	chemical treatment: pentetrazol, chemical treatment: valproic acid	Fig. S4 from McCammon et al., 2017
whole organism increased behavioural activity, exacerbated	doc2a^wi721/+; tlcd3ba^wi720/+	chemical treatment: pentetrazol	Fig. 3 from McCammon et al., 2017
swimming behavior rate, ameliorated	doc2a^wi721/+; tlcd3ba^wi720/+	chemical treatment: pentetrazol, chemical treatment: valproic acid	Fig. S4 from McCammon et al., 2017
eye increased height, abnormal	doc2a^wi721/+; tlcd3ba^wi720/+	standard conditions	Fig. 5 from McCammon et al., 2017
swimming behavior rate, ameliorated	doc2a^wi721/+; tlcd3ba^wi720/+	chemical treatment: pentetrazol, chemical treatment: carbamazepine	Fig. S4 from McCammon et al., 2017
whole organism increased velocity, exacerbated	doc2a^wi721/+; tlcd3ba^wi720/+	chemical treatment: pentetrazol	Fig. 3 from McCammon et al., 2017
whole organism increased behavioural activity, abnormal	doc2a^wi721/+; tlcd3ba^wi720/+	standard conditions	Fig. 3, Table 1 from McCammon et al., 2017
whole organism increased size, abnormal	doc2a^wi721/+; tlcd3ba^wi720/+	standard conditions	Table 1 from McCammon et al., 2017
head increased height, abnormal	doc2a^wi721/+; tlcd3ba^wi720/+	standard conditions	Fig. 5 from McCammon et al., 2017
whole organism increased length, abnormal	doc2a^wi721/+; tlcd3ba^wi720/+	standard conditions	Fig. 4 from McCammon et al., 2017
whole organism velocity, ameliorated	doc2a^wi721/+; tlcd3ba^wi720/+	chemical treatment: pentetrazol, chemical treatment: valproic acid	Fig. S4 from McCammon et al., 2017
head increased size, abnormal	doc2a^wi721/+; tlcd3ba^wi720/+	standard conditions	Table 1 from McCammon et al., 2017
whole organism lipid increased amount, abnormal	doc2a^wi721/+; tlcd3ba^wi720/+	standard conditions	Table 1 from McCammon et al., 2017
forebrain increased width, abnormal	doc2a^wi721/+; tlcd3ba^wi720/+	standard conditions	Fig. 5 from McCammon et al., 2017
brain phosphatidylethanolamine (16:0/22:6) decreased amount, abnormal	tlcd3bb^zf3799/+; tlcd3ba^zf3800/+ (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021
brain phosphatidylethanolamine (18:0/22:6) decreased amount, abnormal	tlcd3bb^zf3799/+; tlcd3ba^zf3800/+ (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021
brain lysophosphatidylcholine decreased amount, abnormal	tlcd3bb^zf3799/+; tlcd3ba^zf3800/+ (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021
brain phosphatidylethanolamine 16:0_20:3 decreased amount, abnormal	tlcd3bb^zf3799/+; tlcd3ba^zf3800/+ (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021
brain phosphatidylethanolamine (18:0/20:3) decreased amount, abnormal	tlcd3bb^zf3799/+; tlcd3ba^zf3800/+ (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021
brain coenzyme decreased amount, abnormal	tlcd3bb^zf3799/+; tlcd3ba^zf3800/+ (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021
brain phosphatidylinositol increased amount, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021
brain phosphatidylethanolamine increased distribution, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	standard conditions	Fig. 7 from Tomasello et al., 2021
brain Ab4-syt1 labeling spatial pattern, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	standard conditions	Fig. 7 from Tomasello et al., 2021
brain ganglioside GM1 increased distribution, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	standard conditions	Fig. 7 from Tomasello et al., 2021
brain Ab4-syt1 labeling increased distribution, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	standard conditions	Fig. 7 from Tomasello et al., 2021
swimming behavior increased process quality, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	chemical treatment by environment: pentetrazol	Fig. 8 from Tomasello et al., 2021
brain membrane raft increased distribution, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	standard conditions	Fig. 7 from Tomasello et al., 2021
startle response decreased process quality, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	altered light dark cycle	Fig. 8 from Tomasello et al., 2021
brain PE(18:1_20:4) increased amount, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021
brain sphingomyelin increased amount, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021
brain lysophosphatidylethanolamine increased amount, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021
brain monoacylglycerol 18:0 increased amount, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021
brain action potential decreased process quality, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	control	Fig. 8 from Tomasello et al., 2021
brain ceramide increased amount, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021
brain HexCer(d18:1/16:0) increased amount, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021
brain monoacylglycerol increased amount, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021
brain PE(18:1_20:3) increased amount, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021
brain action potential propagation decreased process quality, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	control	Fig. 8 from Tomasello et al., 2021
brain cardiolipin increased amount, abnormal	tlcd3bb^{zf3799/zf3799}; tlcd3ba^{zf3800/zf3800} (AB)	standard conditions	Fig. 6 from Tomasello et al., 2021

Citations