TALEN

TALEN1-prrx1a

ID

ZDB-TALEN-170303-2

Name

TALEN1-prrx1a

Previous Names

None

Target

prrx1a (1)

Target Sequence 1

5' - TCCAGACGAGCAGCTCAACG - 3'

Target Sequence 2

5' - TGTTTCGCCTCTGTTTACGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
el558	prrx1a

Expression

Gene expression in Wild Types + TALEN1-prrx1a

No data available

Phenotype

Phenotype resulting from TALEN1-prrx1a

No data available

Phenotype of all Fish created by or utilizing TALEN1-prrx1a

Phenotype	Fish	Conditions	Figures
heart looping disrupted, abnormal	prrx1a^el558/el558 + MO2-prrx1a	standard conditions	Fig. 2 from Tessadori et al., 2020
heart morphology, abnormal	prrx1a^el558/el558 + MO2-prrx1a	standard conditions	Fig. 2 from Tessadori et al., 2020
determination of heart left/right asymmetry disrupted, abnormal	prrx1a^el558/el558 + MO2-prrx1a	standard conditions	Fig. 2 from Tessadori et al., 2020
palatoquadrate cartilage morphology, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 , Fig. 8 , text only from Barske et al., 2016
hyomandibula fused with inner ear, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 , text only from Barske et al., 2016
pharyngeal arch 2 postero-dorsal region barx1 expression increased amount, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 from Barske et al., 2016
pharyngeal arch 2 postero-dorsal region jag1b expression decreased amount, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 8 from Barske et al., 2016
pharyngeal arch 2 dorsal margin barx1 expression increased amount, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 from Barske et al., 2016
pharyngeal arch 2 dorsal margin barx1 expression mislocalised, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 from Barske et al., 2016
pharyngeal arch 2 dorsal margin barx1 expression increased distribution, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 from Barske et al., 2016
pharyngeal arch 1 dorsal region barx1 expression increased amount, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 from Barske et al., 2016
pharyngeal arch 2 postero-dorsal region barx1 expression mislocalised, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 from Barske et al., 2016
hyomandibula malformed, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	text only from Barske et al., 2016
pharyngeal arch 1 dorsal region barx1 expression increased distribution, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 from Barske et al., 2016
palatoquadrate cartilage fused with neurocranial trabecula, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	text only from Barske et al., 2016
pharyngeal arch ventral region barx1 expression decreased amount, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 9 from Barske et al., 2016
entopterygoid absent, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 from Barske et al., 2016
pharyngeal arch 2 postero-dorsal region barx1 expression increased distribution, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 from Barske et al., 2016
palatoquadrate cartilage fused with inner ear, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 , Fig. 8 , text only from Barske et al., 2016
hyomandibula morphology, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 , text only from Barske et al., 2016
pharyngeal arch ventral region dlx5a expression decreased amount, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 9 from Barske et al., 2016
palatoquadrate cartilage mislocalised, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 , Fig. 8 , text only from Barske et al., 2016
pharyngeal arch 1 dorsal region barx1 expression mislocalised, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 from Barske et al., 2016
hyomandibular foramen absent, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	text only from Barske et al., 2016
pharyngeal arch 2 barx1 expression increased distribution, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 7 from Barske et al., 2016
opercle decreased size, abnormal	prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	text only from Barske et al., 2016
determination of heart left/right asymmetry disrupted, abnormal	prrx1a^el558/el558; prrx1b^el491/el491 + MO2-prrx1a	standard conditions	Fig. 2 from Tessadori et al., 2020
heart morphology, abnormal	prrx1a^el558/el558; prrx1b^el491/el491 + MO2-prrx1a	standard conditions	Fig. 2 from Tessadori et al., 2020
heart looping disrupted, abnormal	prrx1a^el558/el558; prrx1b^el491/el491 + MO2-prrx1a	standard conditions	Fig. 2 from Tessadori et al., 2020
pharyngeal arch ventral region dlx5a expression amount, ameliorated	edn1^{tf216b/tf216b}; prrx1a^el558/el558; el49Tg/el49Tg	standard conditions	Fig. 9 from Barske et al., 2016
pharyngeal arch ventral region barx1 expression amount, ameliorated	edn1^{tf216b/tf216b}; prrx1a^el558/el558; el49Tg/el49Tg	standard conditions	Fig. 9 from Barske et al., 2016
pharyngeal arch 1 ventral region morphology, abnormal	edn1^{tf216b/tf216b}; prrx1a^el558/el558; el49Tg/el49Tg	standard conditions	Fig. 9 from Barske et al., 2016
pharyngeal arch cartilage ventral region amount, ameliorated	edn1^{tf216b/tf216b}; prrx1a^el558/el558; el49Tg/el49Tg	standard conditions	Fig. 9 from Barske et al., 2016
pharyngeal arch 2 ventral region size, ameliorated	edn1^{tf216b/tf216b}; prrx1a^el558/el558; el49Tg/el49Tg	standard conditions	Fig. 9 from Barske et al., 2016
pharyngeal arch cartilage ventral region morphology, abnormal	edn1^{tf216b/tf216b}; prrx1a^el558/el558; el49Tg/el49Tg	standard conditions	Fig. 9 from Barske et al., 2016
pharyngeal arch 2 ventral region morphology, abnormal	edn1^{tf216b/tf216b}; prrx1a^el558/el558; el49Tg/el49Tg	standard conditions	Fig. 9 from Barske et al., 2016
palatoquadrate cartilage morphology, abnormal	jag1b^b1105/b1105; prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 8 from Barske et al., 2016
palatoquadrate cartilage mislocalised, abnormal	jag1b^b1105/b1105; prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 8 from Barske et al., 2016
palatoquadrate cartilage fused with inner ear, abnormal	jag1b^b1105/b1105; prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 8 from Barske et al., 2016
Meckel's cartilage length, ameliorated	edn1^{tf216b/tf216b}; jag1b^b1105/b1105; prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 9 from Barske et al., 2016
pharyngeal arch cartilage ventral region morphology, abnormal	edn1^{tf216b/tf216b}; jag1b^b1105/b1105; prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 9 from Barske et al., 2016
ceratohyal cartilage size, ameliorated	edn1^{tf216b/tf216b}; jag1b^b1105/b1105; prrx1a^el558/el558; prrx1b^el491/el491	standard conditions	Fig. 9 from Barske et al., 2016

Citations