TALEN

TALEN1-pitx2

ID
ZDB-TALEN-161003-1
Name
TALEN1-pitx2
Previous Names
None
Target
Target Sequence 1
5' - TTTCAGAGGAATCGCTATCC - 3'
Target Sequence 2
5' - CCAAACGGCGATCTCCTCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
sny15 pitx2
sny6 pitx2
sny7 pitx2
Expression
Gene expression in Wild Types + TALEN1-pitx2
No data available
Phenotype
Phenotype resulting from TALEN1-pitx2
No data available
Phenotype of all Fish created by or utilizing TALEN1-pitx2
Phenotype Fish Conditions Figures
ceratobranchial 5 cartilage lacks parts or has fewer parts of type ceratobranchial 5 primary tooth, abnormal pitx2sny6/sny6 (AB/TU) standard conditions Fig. S5 with image from Ji et al., 2016
aqueous humor decreased volume, abnormal pitx2sny6/sny6 (AB/TU) standard conditions Fig. S5 with image from Ji et al., 2016
cornea morphology, abnormal pitx2sny6/sny6 (AB/TU) standard conditions Fig. S3 with imageFig. S5 with image from Ji et al., 2016
tooth 4V incomplete structure, abnormal pitx2sny6/sny6 (AB/TU) standard conditions Fig. S5 with image from Ji et al., 2016
odontogenesis disrupted, abnormal pitx2sny6/sny6 (AB/TU) standard conditions Fig. S5 with image from Ji et al., 2016
tooth 3V absent, abnormal pitx2sny6/sny6 (AB/TU) standard conditions Fig. S5 with image from Ji et al., 2016
anterior segment eye malformed, abnormal pitx2sny6/sny6 (AB/TU) standard conditions Fig. S5 with image from Ji et al., 2016
camera-type eye morphogenesis disrupted, abnormal pitx2sny6/sny6 (AB/TU) standard conditions Fig. S5 with image from Ji et al., 2016
tooth 5V absent, abnormal pitx2sny6/sny6 (AB/TU) standard conditions Fig. S5 with image from Ji et al., 2016
eye decreased size, abnormal pitx2sny6/sny6 (AB/TU) standard conditions Fig. S3 with image from Ji et al., 2016
iris morphology, abnormal pitx2sny6/sny6 (AB/TU) standard conditions Fig. S3 with imageFig. S5 with image from Ji et al., 2016
odontogenesis disrupted, abnormal pitx2sny7/sny7 (AB/TU) standard conditions Fig. 5 with image from Ji et al., 2016
aqueous humor decreased volume, abnormal pitx2sny7/sny7 (AB/TU) standard conditions Fig. 4 with image from Ji et al., 2016
whole organism viability, abnormal pitx2sny7/sny7 (AB/TU) standard conditions text only from Ji et al., 2016
tooth 4V incomplete structure, abnormal pitx2sny7/sny7 (AB/TU) standard conditions Fig. 5 with image from Ji et al., 2016
cornea morphology, abnormal pitx2sny7/sny7 (AB/TU) standard conditions Fig. 3 with imageFig. 4 with image from Ji et al., 2016
anterior segment eye malformed, abnormal pitx2sny7/sny7 (AB/TU) standard conditions Fig. 4 with image from Ji et al., 2016
tooth 3V absent, abnormal pitx2sny7/sny7 (AB/TU) standard conditions Fig. 5 with image from Ji et al., 2016
tooth 5V absent, abnormal pitx2sny7/sny7 (AB/TU) standard conditions Fig. 5 with image from Ji et al., 2016
camera-type eye morphogenesis disrupted, abnormal pitx2sny7/sny7 (AB/TU) standard conditions Fig. 3 with imageFig. 4 with image from Ji et al., 2016
eye decreased size, abnormal pitx2sny7/sny7 (AB/TU) standard conditions Fig. 3 with image from Ji et al., 2016
iris morphology, abnormal pitx2sny7/sny7 (AB/TU) standard conditions Fig. 3 with imageFig. 4 with image from Ji et al., 2016
ceratobranchial 5 cartilage lacks parts or has fewer parts of type ceratobranchial 5 primary tooth, abnormal pitx2sny7/sny7 (AB/TU) standard conditions Fig. 5 with imagetext only from Ji et al., 2016
whole organism decreased size, abnormal pitx2sny7/sny7 (AB/TU) standard conditions Fig. 3 with image from Ji et al., 2016
whole organism viability, abnormal pitx2sny15/sny15 (AB/TU) standard conditions text only from Ji et al., 2016
cornea morphology, abnormal pitx2sny15/sny15 (AB/TU) standard conditions Fig. S3 with image from Ji et al., 2016
eye decreased size, abnormal pitx2sny15/sny15 (AB/TU) standard conditions Fig. S3 with image from Ji et al., 2016
iris morphology, abnormal pitx2sny15/sny15 (AB/TU) standard conditions Fig. S3 with image from Ji et al., 2016
Citations