TALEN

TALEN1-irx5a

ID
ZDB-TALEN-160204-2
Name
TALEN1-irx5a
Previous Names
None
Target
Target Sequence 1
5' - TGCTCCCCTGGGCTCGTACC - 3'
Target Sequence 2
5' - TCCCGGGTAGCATTCTTGCG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
el574 irx5a
el576 irx5a
Expression
Gene expression in Wild Types + TALEN1-irx5a
No data available
Phenotype
Phenotype resulting from TALEN1-irx5a
No data available
Phenotype of all Fish created by or utilizing TALEN1-irx5a
Phenotype Fish Conditions Figures
ceratohyal cartilage fused with interhyal cartilage, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 6 with image from Askary et al., 2017
Fig. 2 with image from Askary et al., 2015
ceratohyal-interhyal joint chondrocyte increased size, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 2 with image from Askary et al., 2015
interhyal-hyosymplectic joint cartilage development increased process quality, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 2 with image from Askary et al., 2015
ceratohyal-interhyal joint chondrocyte development increased process quality, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 3 with image from Askary et al., 2015
interhyal-hyosymplectic joint absent, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 6 with image from Askary et al., 2017
symplectic decreased length, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 6 with image from Askary et al., 2017
interhyal-hyosymplectic joint malformed, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 2 with image from Askary et al., 2015
interhyal-hyosymplectic joint chondrocyte development increased process quality, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 3 with image from Askary et al., 2015
interhyal-hyosymplectic joint chondrocyte increased size, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 2 with image from Askary et al., 2015
ceratohyal-interhyal joint absent, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 6 with image from Askary et al., 2017
hyosymplectic cartilage fused with interhyal cartilage, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 6 with image from Askary et al., 2017
Fig. 2 with image from Askary et al., 2015
pharyngeal arch 2 skeleton joint ab1-col2a labeling increased amount, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 3 with image from Askary et al., 2015
pharyngeal arch 2 skeleton embryonic skeletal joint development decreased process quality, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 2 with imageFig. 3 with image from Askary et al., 2015
ceratohyal-interhyal joint cartilage development increased process quality, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 2 with image from Askary et al., 2015
pharyngeal arch 2 skeleton lacks all parts of type interhyal-hyosymplectic joint, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 2 with image from Askary et al., 2015
ceratohyal-interhyal joint malformed, abnormal irx5ael574/el574; irx7el538/el538 standard conditions Fig. 2 with image from Askary et al., 2015
symplectic decreased length, abnormal emx2el586/el586; irx5ael574/el574; irx7el538/el538 standard conditions Fig. 6 with image from Askary et al., 2017
opercle decreased size, abnormal emx2el586/el586; irx5ael574/el574; irx7el538/el538 standard conditions Fig. 6 with image from Askary et al., 2017
interhyal-hyosymplectic joint malformed, abnormal emx2el586/el586; irx5ael574/el574; irx7el538/el538 standard conditions Fig. 6 with image from Askary et al., 2017
ceratohyal cartilage decreased size, abnormal irx3ael835/el835; irx5ael576/el576; irx6ael836/el836 standard conditions Fig. 3 with image from Farmer et al., 2021
Meckel's cartilage fused with Meckel's cartilage, abnormal irx3ael835/el835; irx5ael576/el576; irx6ael836/el836 standard conditions Fig. 6 with image from Farmer et al., 2021
quadrate fused with anguloarticular, abnormal irx3ael835/el835; irx5ael576/el576; irx6ael836/el836 standard conditions Fig. 6 with image from Farmer et al., 2021
ceratobranchial cartilage absent, abnormal irx3ael835/el835; irx5ael576/el576; irx6ael836/el836 standard conditions Fig. 3 with image from Farmer et al., 2021
Meckel's cartilage fused with ceratohyal bone, abnormal irx3ael835/el835; irx5ael576/el576; irx6ael836/el836 standard conditions Fig. 6 with image from Farmer et al., 2021
scapulocoracoid decreased size, abnormal irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836 standard conditions Fig. 2 with image from Farmer et al., 2021
pharyngeal arch 6 absent, abnormal irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836 standard conditions Fig. 5 with image from Farmer et al., 2021
pharyngeal arch 7 absent, abnormal irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836 standard conditions Fig. 5 with image from Farmer et al., 2021
pharyngeal pouch 6 absent, abnormal irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836 standard conditions Fig. 5 with image from Farmer et al., 2021
pharyngeal pouch 5 absent, abnormal irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836 standard conditions Fig. 5 with image from Farmer et al., 2021
heart edematous, abnormal irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836 standard conditions Fig. 1 with image from Farmer et al., 2021
pharyngeal pouch 3 absent, abnormal irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836 standard conditions Fig. 5 with image from Farmer et al., 2021
pharyngeal pouch 4 absent, abnormal irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836 standard conditions Fig. 5 with image from Farmer et al., 2021
pharyngeal arch 5 absent, abnormal irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836 standard conditions Fig. 5 with image from Farmer et al., 2021
Meckel's cartilage fused with ceratohyal bone, abnormal irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836; irx7el540/el540 standard conditions Fig. 7 with image from Farmer et al., 2021
ceratobranchial cartilage absent, abnormal irx1bel833/el833; irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836; irx1ael830/+; irx2ael831/+; irx4ael832/+; irx4bel834/el834 standard conditions Fig. 3 with image from Farmer et al., 2021
palatoquadrate cartilage absent, abnormal irx1bel833/el833; irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836; irx7el540/el540; irx1ael830/+; irx2ael831/+; irx4ael832/+; irx4bel834/el834 standard conditions Fig. 3 with image from Farmer et al., 2021
neurocranium absent, abnormal irx1bel833/el833; irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836; irx7el540/el540; irx1ael830/+; irx2ael831/+; irx4ael832/+; irx4bel834/el834 standard conditions Fig. 3 with image from Farmer et al., 2021
ceratohyal cartilage decreased size, abnormal irx1bel833/el833; irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836; irx7el540/el540; irx1ael830/+; irx2ael831/+; irx4ael832/+; irx4bel834/el834 standard conditions Fig. 3 with image from Farmer et al., 2021
ceratobranchial cartilage absent, abnormal irx1bel833/el833; irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836; irx7el540/el540; irx1ael830/+; irx2ael831/+; irx4ael832/+; irx4bel834/el834 standard conditions Fig. 3 with image from Farmer et al., 2021
Meckel's cartilage absent, abnormal irx1bel833/el833; irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836; irx7el540/el540; irx1ael830/+; irx2ael831/+; irx4ael832/+; irx4bel834/el834 standard conditions Fig. 3 with image from Farmer et al., 2021
Citations