Morpholino

MO1-mfge8a

ID
ZDB-MRPHLNO-241122-1
Name
MO1-mfge8a
Previous Names
None
Target
Sequence
5' - GAAGCTCCGGCTCTTCATATTGGTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mfge8a
Expressed Gene Anatomy Figures
her4.1 Fig. 5 from Luo et al., 2023
neurod1 Fig. 5 from Luo et al., 2023
Phenotype
Phenotype resulting from MO1-mfge8a
Phenotype Fish Figures
brain her4.1 expression decreased amount, abnormal AB + MO1-mfge8a Fig. 5 from Luo et al., 2023
brain neurod1 expression increased amount, abnormal AB + MO1-mfge8a Fig. 5 from Luo et al., 2023
brain neurod1 expression increased distribution, abnormal AB + MO1-mfge8a Fig. 5 from Luo et al., 2023
brain Notch signaling pathway decreased process quality, abnormal AB + MO1-mfge8a Fig. 5 from Luo et al., 2023
dorsal telencephalon regulation of neurogenesis decreased process quality, abnormal AB + MO1-mfge8a Fig. 4 from Luo et al., 2023
pleuroperitoneal region lacks all parts of type swim bladder, abnormal AB + MO1-mfge8a Fig. 2 from Luo et al., 2023
radial glial cell stem cell population maintenance decreased process quality, abnormal AB + MO1-mfge8a Fig. 4 from Luo et al., 2023
swimming decreased occurrence, abnormal AB + MO1-mfge8a + MO4-tp53 Fig. 3 from Luo et al., 2023
trunk curved dorsal, abnormal AB + MO1-mfge8a Fig. 2 from Luo et al., 2023
Phenotype of all Fish created by or utilizing MO1-mfge8a
Phenotype Fish Conditions Figures
dorsal telencephalon regulation of neurogenesis decreased process quality, abnormal AB + MO1-mfge8a standard conditions Fig. 4 from Luo et al., 2023
brain neurod1 expression increased amount, abnormal AB + MO1-mfge8a standard conditions Fig. 5 from Luo et al., 2023
brain Notch signaling pathway decreased process quality, abnormal AB + MO1-mfge8a standard conditions Fig. 5 from Luo et al., 2023
brain neurod1 expression increased distribution, abnormal AB + MO1-mfge8a standard conditions Fig. 5 from Luo et al., 2023
brain her4.1 expression decreased amount, abnormal AB + MO1-mfge8a standard conditions Fig. 5 from Luo et al., 2023
trunk curved dorsal, abnormal AB + MO1-mfge8a standard conditions Fig. 2 from Luo et al., 2023
swimming decreased occurrence, abnormal AB + MO1-mfge8a standard conditions Fig. 3 from Luo et al., 2023
pleuroperitoneal region lacks all parts of type swim bladder, abnormal AB + MO1-mfge8a standard conditions Fig. 2 from Luo et al., 2023
radial glial cell stem cell population maintenance decreased process quality, abnormal AB + MO1-mfge8a standard conditions Fig. 4 from Luo et al., 2023
swimming decreased occurrence, abnormal AB + MO1-mfge8a + MO4-tp53 standard conditions Fig. 3 from Luo et al., 2023
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.