Morpholino

MO3-amer1

ID

ZDB-MRPHLNO-200225-2

Name

MO3-amer1

Previous Names

wtx-ATG (1)

Target

amer1 (1)

Sequence

5' - ACAGGTGACTGTGGCTAATGGAGCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-amer1

Expressed Gene	Anatomy	Figures
myod1	segmental plate somite	Fig. 2 , Fig. 6 from Große et al., 2019
pax2a	midbrain hindbrain boundary neural plate	Fig. 2 , Fig. 6 from Große et al., 2019
six3b	anterior neural rod	Fig. 2 , Fig. 6 from Große et al., 2019

Phenotype

Phenotype resulting from MO3-amer1

Phenotype	Fish	Figures
anterior neural rod six3b expression increased distribution, abnormal	WT + MO3-amer1	Fig. 2 from Große et al., 2019
anterior neural rod six3b expression spatial pattern, abnormal	WT + MO3-amer1	Fig. 2 from Große et al., 2019
margin GFP expression increased amount, abnormal	w25Tg/+ + MO3-amer1	Fig. 2 from Große et al., 2019
midbrain hindbrain boundary neural plate pax2a expression increased distribution, abnormal	WT + MO3-amer1	Fig. 2 from Große et al., 2019
midbrain hindbrain boundary neural plate pax2a expression spatial pattern, abnormal	WT + MO3-amer1	Fig. 2 from Große et al., 2019
somite myod1 expression increased distribution, abnormal	WT + MO3-amer1	Fig. 2 from Große et al., 2019
somite myod1 expression spatial pattern, abnormal	WT + MO3-amer1	Fig. 2 from Große et al., 2019

Phenotype of all Fish created by or utilizing MO3-amer1

Phenotype	Fish	Conditions	Figures
midbrain hindbrain boundary neural plate pax2a expression increased distribution, abnormal	WT + MO3-amer1	standard conditions	Fig. 2 from Große et al., 2019
somite myod1 expression spatial pattern, abnormal	WT + MO3-amer1	standard conditions	Fig. 2 from Große et al., 2019
anterior neural rod six3b expression increased distribution, abnormal	WT + MO3-amer1	standard conditions	Fig. 2 from Große et al., 2019
midbrain hindbrain boundary neural plate pax2a expression spatial pattern, abnormal	WT + MO3-amer1	standard conditions	Fig. 2 from Große et al., 2019
somite myod1 expression increased distribution, abnormal	WT + MO3-amer1	standard conditions	Fig. 2 from Große et al., 2019
anterior neural rod six3b expression spatial pattern, abnormal	WT + MO3-amer1	standard conditions	Fig. 2 from Große et al., 2019
margin GFP expression increased amount, abnormal	w25Tg/+ + MO3-amer1	standard conditions	Fig. 2 from Große et al., 2019
somite myod1 expression increased distribution, abnormal	amer1^li17/li17; amer2^li18/li18; amer3^li20/li20 + MO3-amer1	standard conditions	Fig. 6 from Große et al., 2019
anterior neural rod six3b expression spatial pattern, abnormal	amer1^li17/li17; amer2^li18/li18; amer3^li20/li20 + MO3-amer1	standard conditions	Fig. 6 from Große et al., 2019
somite myod1 expression spatial pattern, abnormal	amer1^li17/li17; amer2^li18/li18; amer3^li20/li20 + MO3-amer1	standard conditions	Fig. 6 from Große et al., 2019
midbrain hindbrain boundary neural plate pax2a expression spatial pattern, abnormal	amer1^li17/li17; amer2^li18/li18; amer3^li20/li20 + MO3-amer1	standard conditions	Fig. 6 from Große et al., 2019
midbrain hindbrain boundary neural plate pax2a expression increased distribution, abnormal	amer1^li17/li17; amer2^li18/li18; amer3^li20/li20 + MO3-amer1	standard conditions	Fig. 6 from Große et al., 2019
anterior neural rod six3b expression increased distribution, abnormal	amer1^li17/li17; amer2^li18/li18; amer3^li20/li20 + MO3-amer1	standard conditions	Fig. 6 from Große et al., 2019

Citations