Morpholino

MO1-qdprb.1

ID
ZDB-MRPHLNO-190828-5
Name
MO1-qdprb.1
Previous Names
  • MO1-qdprb1
Target
Sequence
5' - TATTAGGCGAGTACCAACTTTTGGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-qdprb.1
Expressed Gene Anatomy Figures
gch1 Fig. 5 with image from Breuer et al., 2019
gfap Fig. 5 with image from Breuer et al., 2019
glula Fig. 5 with image from Breuer et al., 2019
slc1a2a Fig. 5 with image from Breuer et al., 2019
slc1a2b Fig. 5 with image from Breuer et al., 2019
slc1a3a Fig. S6 with image from Breuer et al., 2019
slc7a5 Fig. S6 with image from Breuer et al., 2019
slc38a2 Fig. S6 with image from Breuer et al., 2019
Phenotype
Phenotype resulting from MO1-qdprb.1
Phenotype Fish Figures
brain decreased size, abnormal knu3Tg + MO1-qdprb.1 Fig. 2 with image,  Fig. 4 with image from Breuer et al., 2019
brain development disrupted, abnormal AB + MO1-qdprb.1 Fig. 2 with image,  Fig. S3 with image from Breuer et al., 2019
eye glula expression absent, abnormal AB + MO1-qdprb.1 Fig. 5 with image from Breuer et al., 2019
eye slc1a2b expression decreased amount, abnormal AB + MO1-qdprb.1 Fig. 5 with image from Breuer et al., 2019
eye decreased size, abnormal knu3Tg + MO1-qdprb.1 Fig. 4 with image from Breuer et al., 2019
eye cell population proliferation increased process quality, abnormal knu3Tg + MO1-qdprb.1 Fig. 4 with image from Breuer et al., 2019
head decreased size, abnormal AB + MO1-qdprb.1 + MO4-tp53 Fig. 2 with image,  Fig. S3 with image from Breuer et al., 2019
hindbrain glula expression decreased amount, abnormal AB + MO1-qdprb.1 Fig. 5 with image from Breuer et al., 2019
hindbrain morphology, abnormal AB + MO1-qdprb.1 Fig. 2 with image,  Fig. S3 with image from Breuer et al., 2019
midbrain slc1a2b expression decreased amount, abnormal AB + MO1-qdprb.1 Fig. 5 with image from Breuer et al., 2019
midbrain glula expression decreased amount, abnormal AB + MO1-qdprb.1 Fig. 5 with image from Breuer et al., 2019
midbrain morphology, abnormal AB + MO1-qdprb.1 + MO4-tp53 Fig. 2 with image,  Fig. S3 with image from Breuer et al., 2019
optic tectum decreased size, abnormal knu3Tg + MO1-qdprb.1 Fig. 4 with image from Breuer et al., 2019
optic tectum cell population proliferation increased process quality, abnormal knu3Tg + MO1-qdprb.1 Fig. 4 with image from Breuer et al., 2019
retinal outer nuclear layer slc1a2a expression decreased amount, abnormal AB + MO1-qdprb.1 Fig. 5 with image from Breuer et al., 2019
whole organism slc38a2 expression decreased amount, abnormal AB + MO1-qdprb.1 Fig. S6 with image from Breuer et al., 2019
whole organism slc1a2a expression decreased amount, abnormal AB + MO1-qdprb.1 Fig. 5 with image from Breuer et al., 2019
whole organism gfap expression decreased amount, abnormal AB + MO1-qdprb.1 Fig. 5 with image from Breuer et al., 2019
whole organism glula expression decreased amount, abnormal AB + MO1-qdprb.1 Fig. 5 with image from Breuer et al., 2019
whole organism glutamine increased amount, abnormal AB + MO1-qdprb.1 + MO4-tp53 Fig. 3,  Fig. S4 from Breuer et al., 2019
Phenotype of all Fish created by or utilizing MO1-qdprb.1
Phenotype Fish Conditions Figures
brain decreased size, abnormal AB + MO1-qdprb.1 standard conditions Fig. 2 with image from Breuer et al., 2019
whole organism slc38a2 expression decreased amount, abnormal AB + MO1-qdprb.1 control Fig. S6 with image from Breuer et al., 2019
whole organism gfap expression decreased amount, abnormal AB + MO1-qdprb.1 control Fig. 5 with image from Breuer et al., 2019
hindbrain glula expression decreased amount, abnormal AB + MO1-qdprb.1 control Fig. 5 with image from Breuer et al., 2019
retinal outer nuclear layer slc1a2a expression decreased amount, abnormal AB + MO1-qdprb.1 control Fig. 5 with image from Breuer et al., 2019
head decreased size, abnormal AB + MO1-qdprb.1 standard conditions Fig. 2 with image from Breuer et al., 2019
whole organism glula expression decreased amount, abnormal AB + MO1-qdprb.1 control Fig. 5 with image from Breuer et al., 2019
eye glula expression absent, abnormal AB + MO1-qdprb.1 control Fig. 5 with image from Breuer et al., 2019
midbrain slc1a2b expression decreased amount, abnormal AB + MO1-qdprb.1 control Fig. 5 with image from Breuer et al., 2019
hindbrain morphology, abnormal AB + MO1-qdprb.1 standard conditions Fig. 2 with image from Breuer et al., 2019
whole organism glutamine increased amount, abnormal AB + MO1-qdprb.1 standard conditions Fig. 3 from Breuer et al., 2019
brain development disrupted, abnormal AB + MO1-qdprb.1 standard conditions Fig. 2 with image from Breuer et al., 2019
whole organism slc1a2a expression decreased amount, abnormal AB + MO1-qdprb.1 control Fig. 5 with image from Breuer et al., 2019
midbrain glula expression decreased amount, abnormal AB + MO1-qdprb.1 control Fig. 5 with image from Breuer et al., 2019
midbrain morphology, abnormal AB + MO1-qdprb.1 standard conditions Fig. 2 with image from Breuer et al., 2019
eye slc1a2b expression decreased amount, abnormal AB + MO1-qdprb.1 control Fig. 5 with image from Breuer et al., 2019
head decreased size, abnormal AB + MO1-qdprb.1 + MO4-tp53 standard conditions Fig. S3 with image from Breuer et al., 2019
hindbrain morphology, abnormal AB + MO1-qdprb.1 + MO4-tp53 standard conditions Fig. S3 with image from Breuer et al., 2019
whole organism glutamine increased amount, abnormal AB + MO1-qdprb.1 + MO4-tp53 standard conditions Fig. S4 from Breuer et al., 2019
brain development disrupted, abnormal AB + MO1-qdprb.1 + MO4-tp53 standard conditions Fig. S3 with image from Breuer et al., 2019
midbrain morphology, abnormal AB + MO1-qdprb.1 + MO4-tp53 standard conditions Fig. S3 with image from Breuer et al., 2019
eye decreased size, abnormal knu3Tg + MO1-qdprb.1 standard conditions Fig. 4 with image from Breuer et al., 2019
eye cell population proliferation increased process quality, abnormal knu3Tg + MO1-qdprb.1 standard conditions Fig. 4 with image from Breuer et al., 2019
optic tectum decreased size, abnormal knu3Tg + MO1-qdprb.1 standard conditions Fig. 4 with image from Breuer et al., 2019
optic tectum cell population proliferation increased process quality, abnormal knu3Tg + MO1-qdprb.1 standard conditions Fig. 4 with image from Breuer et al., 2019
brain decreased size, abnormal knu3Tg + MO1-qdprb.1 standard conditions Fig. 4 with image from Breuer et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.