Morpholino

MO1-cep128

ID
ZDB-MRPHLNO-180719-1
Name
MO1-cep128
Previous Names
  • cep128_splx1 (1)
Target
Sequence
5' - TAAAGACATCTTACCTGGAGAGTGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cep128
Expressed Gene Anatomy Figures
chrd Fig. 2 with image,  Fig. S3 with image from Mönnich et al., 2018
eve1 Fig. 2 with image,  Fig. S3 with image from Mönnich et al., 2018
gsc Fig. 2 with image,  Fig. S3 with image from Mönnich et al., 2018
mixl1 Fig. S3 with image from Mönnich et al., 2018
nog1 Fig. S3 with image from Mönnich et al., 2018
smad7 Fig. S3 with image from Mönnich et al., 2018
sox17 Fig. S3 with image from Mönnich et al., 2018
tbxta Fig. 2 with image from Mönnich et al., 2018
Phenotype
Phenotype resulting from MO1-cep128
Phenotype Fish Figures
heart development disrupted, abnormal AB/TL + MO1-cep128 Fig. S3 with image from Mönnich et al., 2018
liver decreased size, abnormal AB/TL + MO1-cep128 Fig. S3 with image from Mönnich et al., 2018
margin eve1 expression decreased amount, abnormal AB/TL + MO1-cep128 Fig. 2 with image from Mönnich et al., 2018
notochord bent, abnormal AB/TL + MO1-cep128 Fig. 2 with image from Mönnich et al., 2018
notochord increased thickness, abnormal AB/TL + MO1-cep128 Fig. 2 with image from Mönnich et al., 2018
notochord tbxta expression spatial pattern, abnormal AB/TL + MO1-cep128 Fig. 2 with image from Mönnich et al., 2018
pancreas decreased size, abnormal AB/TL + MO1-cep128 Fig. S3 with image from Mönnich et al., 2018
shield gsc expression increased distribution, abnormal AB/TL + MO1-cep128 Fig. 2 with image from Mönnich et al., 2018
shield chrd expression increased distribution, abnormal AB/TL + MO1-cep128 Fig. 2 with image from Mönnich et al., 2018
somite decreased thickness, abnormal AB/TL + MO1-cep128 Fig. 2 with image from Mönnich et al., 2018
somite elongated, abnormal AB/TL + MO1-cep128 Fig. 2 with image from Mönnich et al., 2018
tail bud tbxta expression spatial pattern, abnormal AB/TL + MO1-cep128 Fig. 2 with image from Mönnich et al., 2018
whole organism Ab12-smad labeling decreased amount, abnormal AB/TL + MO1-cep128 Fig. 2 with image from Mönnich et al., 2018
whole organism Ab11-smad2 labeling decreased amount, abnormal AB/TL + MO1-cep128 Fig. 2 with image from Mönnich et al., 2018
whole organism dorsalized, abnormal AB/TL + MO1-cep128 Fig. 2 with image from Mönnich et al., 2018
whole organism mixl1 expression increased amount, abnormal AB/TL + MO1-cep128 Fig. S3 with image from Mönnich et al., 2018
whole organism chrd expression increased amount, abnormal AB/TL + MO1-cep128 Fig. S3 with image from Mönnich et al., 2018
whole organism eve1 expression increased amount, abnormal AB/TL + MO1-cep128 Fig. S3 with image from Mönnich et al., 2018
whole organism smad7 expression increased amount, abnormal AB/TL + MO1-cep128 Fig. S3 with image from Mönnich et al., 2018
whole organism sox17 expression increased amount, abnormal AB/TL + MO1-cep128 Fig. S3 with image from Mönnich et al., 2018
whole organism gsc expression increased amount, abnormal AB/TL + MO1-cep128 Fig. S3 with image from Mönnich et al., 2018
whole organism nog1 expression increased amount, abnormal AB/TL + MO1-cep128 Fig. S3 with image from Mönnich et al., 2018
whole organism ovate, abnormal AB/TL + MO1-cep128 Fig. 2 with image from Mönnich et al., 2018
Phenotype of all Fish created by or utilizing MO1-cep128
Phenotype Fish Conditions Figures
whole organism mixl1 expression increased amount, abnormal AB/TL + MO1-cep128 standard conditions Fig. S3 with image from Mönnich et al., 2018
pancreas decreased size, abnormal AB/TL + MO1-cep128 standard conditions Fig. S3 with image from Mönnich et al., 2018
whole organism chrd expression increased amount, abnormal AB/TL + MO1-cep128 standard conditions Fig. S3 with image from Mönnich et al., 2018
margin eve1 expression decreased amount, abnormal AB/TL + MO1-cep128 standard conditions Fig. 2 with image from Mönnich et al., 2018
shield gsc expression increased distribution, abnormal AB/TL + MO1-cep128 standard conditions Fig. 2 with image from Mönnich et al., 2018
heart development disrupted, abnormal AB/TL + MO1-cep128 standard conditions Fig. S3 with image from Mönnich et al., 2018
somite elongated, abnormal AB/TL + MO1-cep128 standard conditions Fig. 2 with image from Mönnich et al., 2018
shield chrd expression increased distribution, abnormal AB/TL + MO1-cep128 standard conditions Fig. 2 with image from Mönnich et al., 2018
whole organism Ab12-smad labeling decreased amount, abnormal AB/TL + MO1-cep128 standard conditions Fig. 2 with image from Mönnich et al., 2018
notochord bent, abnormal AB/TL + MO1-cep128 standard conditions Fig. 2 with image from Mönnich et al., 2018
notochord increased thickness, abnormal AB/TL + MO1-cep128 standard conditions Fig. 2 with image from Mönnich et al., 2018
whole organism dorsalized, abnormal AB/TL + MO1-cep128 standard conditions Fig. 2 with image from Mönnich et al., 2018
tail bud tbxta expression spatial pattern, abnormal AB/TL + MO1-cep128 standard conditions Fig. 2 with image from Mönnich et al., 2018
whole organism Ab11-smad2 labeling decreased amount, abnormal AB/TL + MO1-cep128 standard conditions Fig. 2 with image from Mönnich et al., 2018
liver decreased size, abnormal AB/TL + MO1-cep128 standard conditions Fig. S3 with image from Mönnich et al., 2018
whole organism nog1 expression increased amount, abnormal AB/TL + MO1-cep128 standard conditions Fig. S3 with image from Mönnich et al., 2018
whole organism eve1 expression increased amount, abnormal AB/TL + MO1-cep128 standard conditions Fig. S3 with image from Mönnich et al., 2018
whole organism smad7 expression increased amount, abnormal AB/TL + MO1-cep128 standard conditions Fig. S3 with image from Mönnich et al., 2018
notochord tbxta expression spatial pattern, abnormal AB/TL + MO1-cep128 standard conditions Fig. 2 with image from Mönnich et al., 2018
whole organism gsc expression increased amount, abnormal AB/TL + MO1-cep128 standard conditions Fig. S3 with image from Mönnich et al., 2018
whole organism ovate, abnormal AB/TL + MO1-cep128 standard conditions Fig. 2 with image from Mönnich et al., 2018
somite decreased thickness, abnormal AB/TL + MO1-cep128 standard conditions Fig. 2 with image from Mönnich et al., 2018
whole organism sox17 expression increased amount, abnormal AB/TL + MO1-cep128 standard conditions Fig. S3 with image from Mönnich et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.