Morpholino

MO2-lpar2b

ID
ZDB-MRPHLNO-180712-1
Name
MO2-lpar2b
Previous Names
None
Target
Sequence
5' - TCTGATTGGCTGAGCTGAAGGGATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-lpar2b
Expressed Gene Anatomy Figures
ackr3b Fig. 3 with image from Wang et al., 2018
cxcr4b Fig. 3 with image from Wang et al., 2018
etv4 Fig. 3 with image from Wang et al., 2018
fgf10a Fig. 3 with image from Wang et al., 2018
fgfr1a Fig. 3 with image from Wang et al., 2018
lef1 Fig. 3 with image from Wang et al., 2018
prox1a Fig. 5 with image from Wang et al., 2018
Phenotype
Phenotype resulting from MO2-lpar2b
Phenotype Fish Figures
posterior lateral line neuromast has fewer parts of type hair cell, abnormal s356tTg + MO2-lpar2b Fig. 2 with image from Wang et al., 2018
posterior lateral line primordium ab1-yap1 labeling absent, abnormal AB + MO2-lpar2b Fig. S4 with image from Wang et al., 2018
posterior lateral line primordium prox1a expression decreased amount, abnormal AB + MO2-lpar2b Fig. 5 with image from Wang et al., 2018
posterior lateral line primordium fgfr1a expression decreased amount, abnormal AB + MO2-lpar2b Fig. 3 with image from Wang et al., 2018
posterior lateral line primordium cxcr4b expression decreased amount, abnormal AB + MO2-lpar2b Fig. 3 with image from Wang et al., 2018
posterior lateral line primordium etv4 expression decreased amount, abnormal AB + MO2-lpar2b Fig. 3 with image from Wang et al., 2018
posterior lateral line primordium ackr3b expression decreased distribution, abnormal AB + MO2-lpar2b Fig. 3 with image from Wang et al., 2018
posterior lateral line primordium prox1a expression decreased distribution, abnormal AB + MO2-lpar2b Fig. 5 with image from Wang et al., 2018
posterior lateral line primordium fgfr1a expression decreased distribution, abnormal AB + MO2-lpar2b Fig. 3 with image from Wang et al., 2018
posterior lateral line primordium EGFP expression decreased distribution, abnormal zf551Tg + MO2-lpar2b Fig. 4 with image from Wang et al., 2018
posterior lateral line primordium etv4 expression decreased distribution, abnormal AB + MO2-lpar2b Fig. 3 with image from Wang et al., 2018
posterior lateral line primordium decreased size, abnormal AB + MO2-lpar2b Fig. 3 with image,  Fig. S3 with image from Wang et al., 2018
posterior lateral line primordium has fewer parts of type cell, abnormal zf551Tg + MO2-lpar2b Fig. 4 with image from Wang et al., 2018
posterior lateral line primordium lef1 expression increased distribution, abnormal AB + MO2-lpar2b Fig. 3 with image from Wang et al., 2018
posterior lateral line primordium fgf10a expression increased distribution, abnormal AB + MO2-lpar2b Fig. 3 with image from Wang et al., 2018
pronephric duct ab1-yap1 labeling absent, abnormal AB + MO2-lpar2b Fig. S4 with image from Wang et al., 2018
whole organism has fewer parts of type posterior lateral line neuromast, abnormal zf551Tg + MO2-lpar2b Fig. 2 with image,  Fig. 6 with image from Wang et al., 2018
Phenotype of all Fish created by or utilizing MO2-lpar2b
Phenotype Fish Conditions Figures
posterior lateral line primordium prox1a expression decreased amount, abnormal AB + MO2-lpar2b standard conditions Fig. 5 with image from Wang et al., 2018
posterior lateral line primordium etv4 expression decreased distribution, abnormal AB + MO2-lpar2b standard conditions Fig. 3 with image from Wang et al., 2018
pronephric duct ab1-yap1 labeling absent, abnormal AB + MO2-lpar2b standard conditions Fig. S4 with image from Wang et al., 2018
posterior lateral line primordium fgf10a expression increased distribution, abnormal AB + MO2-lpar2b standard conditions Fig. 3 with image from Wang et al., 2018
posterior lateral line primordium prox1a expression decreased distribution, abnormal AB + MO2-lpar2b standard conditions Fig. 5 with image from Wang et al., 2018
posterior lateral line primordium fgfr1a expression decreased amount, abnormal AB + MO2-lpar2b standard conditions Fig. 3 with image from Wang et al., 2018
posterior lateral line primordium ab1-yap1 labeling absent, abnormal AB + MO2-lpar2b standard conditions Fig. S4 with image from Wang et al., 2018
posterior lateral line primordium cxcr4b expression decreased amount, abnormal AB + MO2-lpar2b standard conditions Fig. 3 with image from Wang et al., 2018
posterior lateral line primordium fgfr1a expression decreased distribution, abnormal AB + MO2-lpar2b standard conditions Fig. 3 with image from Wang et al., 2018
posterior lateral line primordium ackr3b expression decreased distribution, abnormal AB + MO2-lpar2b standard conditions Fig. 3 with image from Wang et al., 2018
posterior lateral line primordium decreased size, abnormal AB + MO2-lpar2b standard conditions Fig. 3 with image from Wang et al., 2018
posterior lateral line primordium etv4 expression decreased amount, abnormal AB + MO2-lpar2b standard conditions Fig. 3 with image from Wang et al., 2018
posterior lateral line primordium lef1 expression increased distribution, abnormal AB + MO2-lpar2b standard conditions Fig. 3 with image from Wang et al., 2018
posterior lateral line neuromast has fewer parts of type hair cell, abnormal s356tTg + MO2-lpar2b standard conditions Fig. 2 with image from Wang et al., 2018
posterior lateral line primordium decreased size, abnormal zf106Tg + MO2-lpar2b standard conditions Fig. 3 with image,  Fig. S3 with image from Wang et al., 2018
whole organism has fewer parts of type posterior lateral line neuromast, abnormal zf551Tg + MO2-lpar2b standard conditions Fig. 2 with image,  Fig. 6 with image from Wang et al., 2018
posterior lateral line primordium EGFP expression decreased distribution, abnormal zf551Tg + MO2-lpar2b standard conditions Fig. 4 with image from Wang et al., 2018
posterior lateral line primordium has fewer parts of type cell, abnormal zf551Tg + MO2-lpar2b standard conditions Fig. 4 with image from Wang et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.