Morpholino

MO1-lamc3

ID

ZDB-MRPHLNO-180615-3

Name

MO1-lamc3

Previous Names

None

Target

Sequence

5' - AGCCCAGTAGGGAGTCTTACCAAGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-lamc3

No data available

Phenotype

Phenotype resulting from MO1-lamc3

Phenotype	Fish	Figures
CaP motoneuron increased branchiness, abnormal	mi2001Tg + MO1-lamc3 + MO4-tp53	Fig. 4 from Eve et al., 2017
intersegmental vessel parachordal vessel decreased amount, abnormal	sd2Tg; y1Tg + MO1-lamc3 + MO4-tp53	Fig. 2 from Eve et al., 2017
muscle pioneer ntn1a expression increased distribution, abnormal	AB + MO1-lamc3 + MO4-tp53	Fig. 4 from Eve et al., 2017
parachordal vessel aplastic, abnormal	sd2Tg; y1Tg + MO1-lamc3 + MO4-tp53	Fig. 2 from Eve et al., 2017
primary motor neuron shape, abnormal	mi2001Tg + MO1-lamc3 + MO4-tp53	Fig. 4 from Eve et al., 2017
RoP motor neuron decreased amount, abnormal	mi2001Tg + MO1-lamc3 + MO4-tp53	Fig. 4 from Eve et al., 2017
slow muscle cell TagRFP expression increased distribution, abnormal	nim5Tg + MO1-lamc3 + MO4-tp53	Fig. 4 from Eve et al., 2017
somite TagRFP expression mislocalised, abnormal	nim5Tg + MO1-lamc3 + MO4-tp53	Fig. 4 from Eve et al., 2017
thoracic duct absent, abnormal	nim5Tg; y1Tg + MO1-lamc3 + MO4-tp53	Fig. 2 from Eve et al., 2017
trunk Ab1-ntn1 labeling increased distribution, abnormal	AB + MO1-lamc3 + MO4-tp53	Fig. 4 from Eve et al., 2017
trunk Ab1-ntn1 labeling spatial pattern, abnormal	AB + MO1-lamc3 + MO4-tp53	Fig. 4 from Eve et al., 2017

Phenotype of all Fish created by or utilizing MO1-lamc3

Phenotype	Fish	Conditions	Figures
trunk Ab1-ntn1 labeling increased distribution, abnormal	AB + MO1-lamc3 + MO4-tp53	standard conditions	Fig. 4 from Eve et al., 2017
muscle pioneer ntn1a expression increased distribution, abnormal	AB + MO1-lamc3 + MO4-tp53	standard conditions	Fig. 4 from Eve et al., 2017
trunk Ab1-ntn1 labeling spatial pattern, abnormal	AB + MO1-lamc3 + MO4-tp53	standard conditions	Fig. 4 from Eve et al., 2017
CaP motoneuron increased branchiness, abnormal	mi2001Tg + MO1-lamc3 + MO4-tp53	standard conditions	Fig. 4 from Eve et al., 2017
RoP motor neuron decreased amount, abnormal	mi2001Tg + MO1-lamc3 + MO4-tp53	standard conditions	Fig. 4 from Eve et al., 2017
primary motor neuron shape, abnormal	mi2001Tg + MO1-lamc3 + MO4-tp53	standard conditions	Fig. 4 from Eve et al., 2017
somite TagRFP expression mislocalised, abnormal	nim5Tg + MO1-lamc3 + MO4-tp53	standard conditions	Fig. 4 from Eve et al., 2017
slow muscle cell TagRFP expression increased distribution, abnormal	nim5Tg + MO1-lamc3 + MO4-tp53	standard conditions	Fig. 4 from Eve et al., 2017
thoracic duct absent, abnormal	nim5Tg; y1Tg + MO1-lamc3 + MO4-tp53	standard conditions	Fig. 2 from Eve et al., 2017
intersegmental vessel parachordal vessel decreased amount, abnormal	sd2Tg; y1Tg + MO1-lamc3 + MO4-tp53	standard conditions	Fig. 2 from Eve et al., 2017
parachordal vessel aplastic, abnormal	sd2Tg; y1Tg + MO1-lamc3 + MO4-tp53	standard conditions	Fig. 2 from Eve et al., 2017

Citations