Morpholino

MO1-g6pc3

ID

ZDB-MRPHLNO-180613-1

Name

MO1-g6pc3

Previous Names

None

Target

Sequence

5' - AGTGTTATACTGCTGTACCTGGACC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-g6pc3

Expressed Gene	Anatomy	Figures
mpx	myeloid cell ventral wall of dorsal aorta	Fig. 6 from Zhang et al., 2017
runx1	hematopoietic stem cell ventral wall of dorsal aorta	Fig. 6 from Zhang et al., 2017
tal1	ventral wall of dorsal aorta	Fig. 6 from Zhang et al., 2017

Phenotype

Phenotype resulting from MO1-g6pc3

Phenotype	Fish	Figures
hematopoietic stem cell decreased amount, abnormal	WT + MO1-g6pc3	Fig. 6 from Zhang et al., 2017
myeloid cell differentiation decreased occurrence, abnormal	WT + MO1-g6pc3	Fig. 6 from Zhang et al., 2017
ventral wall of dorsal aorta tal1 expression decreased amount, abnormal	WT + MO1-g6pc3	Fig. 6 from Zhang et al., 2017
ventral wall of dorsal aorta mpx expression decreased amount, abnormal	WT + MO1-g6pc3	Fig. 6 from Zhang et al., 2017
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal	WT + MO1-g6pc3	Fig. 6 from Zhang et al., 2017
ventral wall of dorsal aorta GFP expression decreased amount, abnormal	zf2128Tg + MO1-g6pc3	Fig. 6 from Zhang et al., 2017
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal	WT + MO1-g6pc3	Fig. 6 from Zhang et al., 2017

Phenotype of all Fish created by or utilizing MO1-g6pc3

Phenotype	Fish	Conditions	Figures
ventral wall of dorsal aorta tal1 expression decreased amount, abnormal	WT + MO1-g6pc3	standard conditions	Fig. 6 from Zhang et al., 2017
myeloid cell differentiation decreased occurrence, abnormal	WT + MO1-g6pc3	standard conditions	Fig. 6 from Zhang et al., 2017
hematopoietic stem cell decreased amount, abnormal	WT + MO1-g6pc3	standard conditions	Fig. 6 from Zhang et al., 2017
ventral wall of dorsal aorta mpx expression decreased amount, abnormal	WT + MO1-g6pc3	standard conditions	Fig. 6 from Zhang et al., 2017
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal	WT + MO1-g6pc3	standard conditions	Fig. 6 from Zhang et al., 2017
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal	WT + MO1-g6pc3	standard conditions	Fig. 6 from Zhang et al., 2017
ventral wall of dorsal aorta GFP expression decreased amount, abnormal	zf2128Tg + MO1-g6pc3	standard conditions	Fig. 6 from Zhang et al., 2017
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal	zf2128Tg + MO1-g6pc3	standard conditions	Fig. 6 from Zhang et al., 2017

Citations