Morpholino

MO1-tekt1

ID
ZDB-MRPHLNO-180530-1
Name
MO1-tekt1
Previous Names
None
Target
Sequence
5' - GGTTGGTTTGTTTTACATACCCAGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tekt1
Expressed Gene Anatomy Figures
spaw Fig. 7 from Ryan et al., 2017
Phenotype
Phenotype resulting from MO1-tekt1
Phenotype Fish Figures
determination of heart left/right asymmetry decreased process quality, abnormal WT + MO1-tekt1 Fig. 7 from Ryan et al., 2017
heart bilateral symmetry, abnormal WT + MO1-tekt1 Fig. 7 from Ryan et al., 2017
heart heart morphogenesis decreased process quality, abnormal WT + MO1-tekt1 Fig. 9 from Ryan et al., 2017
Kupffer's vesicle has fewer parts of type Kupffer's vesicle motile cilium, abnormal hsc5Tg + MO1-tekt1 Fig. 8 from Ryan et al., 2017
Kupffer's vesicle epithelial cilium movement involved in extracellular fluid movement decreased process quality, abnormal hsc5Tg + MO1-tekt1 Fig. 8 from Ryan et al., 2017
Kupffer's vesicle motile cilium assembly decreased occurrence, abnormal hsc5Tg + MO1-tekt1 Fig. 8 from Ryan et al., 2017
lateral plate mesoderm determination of left/right asymmetry in lateral mesoderm decreased process quality, abnormal WT + MO1-tekt1 Fig. 7 from Ryan et al., 2017
lateral plate mesoderm right side spaw expression mislocalised, abnormal WT + MO1-tekt1 Fig. 7 from Ryan et al., 2017
otic vesicle has extra parts of type otolith, abnormal WT + MO1-tekt1 Fig. 7 from Ryan et al., 2017
otic vesicle otolith development decreased process quality, abnormal WT + MO1-tekt1 Fig. 9 from Ryan et al., 2017
otolith malformed, abnormal WT + MO1-tekt1 Fig. 7 from Ryan et al., 2017
otolith development decreased process quality, abnormal WT + MO1-tekt1 Fig. 7 from Ryan et al., 2017
post-vent region curved ventral, abnormal WT + MO1-tekt1 Fig. 9 from Ryan et al., 2017
pronephros cystic, abnormal li1Tg + MO1-tekt1 Fig. 7,  Fig. 9 from Ryan et al., 2017
pronephros epithelial cilium movement involved in extracellular fluid movement decreased process quality, abnormal hsc5Tg + MO1-tekt1 Fig. 8 from Ryan et al., 2017
pronephros development decreased process quality, abnormal WT + MO1-tekt1 Fig. 7,  Fig. 9 from Ryan et al., 2017
Phenotype of all Fish created by or utilizing MO1-tekt1
Phenotype Fish Conditions Figures
heart bilateral symmetry, abnormal WT + MO1-tekt1 standard conditions Fig. 7 from Ryan et al., 2017
pronephros development decreased process quality, abnormal WT + MO1-tekt1 standard conditions Fig. 9 from Ryan et al., 2017
otic vesicle otolith development decreased process quality, abnormal WT + MO1-tekt1 standard conditions Fig. 9 from Ryan et al., 2017
otic vesicle has extra parts of type otolith, abnormal WT + MO1-tekt1 standard conditions Fig. 7 from Ryan et al., 2017
lateral plate mesoderm right side spaw expression mislocalised, abnormal WT + MO1-tekt1 standard conditions Fig. 7 from Ryan et al., 2017
otolith development decreased process quality, abnormal WT + MO1-tekt1 standard conditions Fig. 7 from Ryan et al., 2017
determination of heart left/right asymmetry decreased process quality, abnormal WT + MO1-tekt1 standard conditions Fig. 7 from Ryan et al., 2017
lateral plate mesoderm determination of left/right asymmetry in lateral mesoderm decreased process quality, abnormal WT + MO1-tekt1 standard conditions Fig. 7 from Ryan et al., 2017
post-vent region curved ventral, abnormal WT + MO1-tekt1 standard conditions Fig. 9 from Ryan et al., 2017
otolith malformed, abnormal WT + MO1-tekt1 standard conditions Fig. 7 from Ryan et al., 2017
pronephros cystic, abnormal WT + MO1-tekt1 standard conditions Fig. 9 from Ryan et al., 2017
heart heart morphogenesis decreased process quality, abnormal WT + MO1-tekt1 standard conditions Fig. 9 from Ryan et al., 2017
pronephros epithelial cilium movement involved in extracellular fluid movement decreased process quality, abnormal hsc5Tg + MO1-tekt1 standard conditions Fig. 8 from Ryan et al., 2017
Kupffer's vesicle has fewer parts of type Kupffer's vesicle motile cilium, abnormal hsc5Tg + MO1-tekt1 standard conditions Fig. 8 from Ryan et al., 2017
Kupffer's vesicle epithelial cilium movement involved in extracellular fluid movement decreased process quality, abnormal hsc5Tg + MO1-tekt1 standard conditions Fig. 8 from Ryan et al., 2017
Kupffer's vesicle motile cilium assembly decreased occurrence, abnormal hsc5Tg + MO1-tekt1 standard conditions Fig. 8 from Ryan et al., 2017
pronephros cystic, abnormal li1Tg + MO1-tekt1 standard conditions Fig. 7 from Ryan et al., 2017
pronephros development decreased process quality, abnormal li1Tg + MO1-tekt1 standard conditions Fig. 7 from Ryan et al., 2017
pronephros development decreased process quality, abnormal WT + MO1-tekt1 + MO1-wdr19 standard conditions Fig. 9 from Ryan et al., 2017
otic vesicle otolith development decreased process quality, abnormal WT + MO1-tekt1 + MO1-wdr19 standard conditions Fig. 9 from Ryan et al., 2017
post-vent region curved ventral, abnormal WT + MO1-tekt1 + MO1-wdr19 standard conditions Fig. 9 from Ryan et al., 2017
brain hydrocephalic, abnormal WT + MO1-tekt1 + MO1-wdr19 standard conditions Fig. 9 from Ryan et al., 2017
head decreased size, abnormal WT + MO1-tekt1 + MO1-wdr19 standard conditions Fig. 9 from Ryan et al., 2017
pronephros cystic, abnormal WT + MO1-tekt1 + MO1-wdr19 standard conditions Fig. 9 from Ryan et al., 2017
heart heart morphogenesis decreased process quality, abnormal WT + MO1-tekt1 + MO1-wdr19 standard conditions Fig. 9 from Ryan et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.