Morpholino
MO1-acvr2bb
- ID
- ZDB-MRPHLNO-180503-7
- Name
- MO1-acvr2bb
- Previous Names
- None
- Target
- Sequence
-
5' - AGCCAGCCAGGGAACAAACATATTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-acvr2bb
No data available
Phenotype
Phenotype resulting from MO1-acvr2bb
No data available
Phenotype of all Fish created by or utilizing MO1-acvr2bb
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| heart cardiac muscle cell proliferation decreased occurrence, ameliorated | bns145Tg; hsc4Tg + MO1-acvr2bb | standard conditions |
Fig. 7 
from Dogra et al., 2017 |
1 - 1 of 1
Citations
- Lalonde, R.L., Nicolas, H.A., Cutler, R.S., Pantekidis, I., Zhang, W., Yelick, P.C. (2023) Functional comparison of human ACVR1 and zebrafish Acvr1l FOP-associated variants in embryonic zebrafish. Developmental Dynamics : an official publication of the American Association of Anatomists. 252(5):605-628
- Preiß, H., Kögler, A.C., Mörsdorf, D., Čapek, D., Soh, G.H., Rogers, K.W., Morales-Navarrete, H., Almuedo-Castillo, M., Müller, P. (2022) Regulation of Nodal signaling propagation by receptor interactions and positive feedback. eLIFE. 11:
- Dogra, D., Ahuja, S., Kim, H.T., Rasouli, S.J., Stainier, D.Y.R., Reischauer, S. (2017) Opposite effects of Activin type 2 receptor ligands on cardiomyocyte proliferation during development and repair. Nature communications. 8:1902
1 - 3 of 3
Show