Morpholino

MO1-prr7

ID

ZDB-MRPHLNO-180323-1

Name

MO1-prr7

Previous Names

None

Target

Sequence

5' - AGGTGCCCTGCGACATCACCATGAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-prr7

Expressed Gene	Anatomy	Figures
hoxb1b	neuroectoderm posterior region	Fig. 4 from Kim et al., 2017
rx1	optic vesicle	Fig. s6 from Kim et al., 2017
six3b	neuroectoderm anterior region	Fig. 4 from Kim et al., 2017
tbx16	segmental plate	Fig. 4 from Kim et al., 2017
zic1	optic primordium	Fig. s6 from Kim et al., 2017

Phenotype

Phenotype resulting from MO1-prr7

Phenotype	Fish	Figures
eye decreased size, abnormal	WT + MO11-tp53 + MO1-prr7	Fig. s6 from Kim et al., 2017
head decreased size, abnormal	WT + MO1-prr7	Fig. s6 from Kim et al., 2017
intermediate cell mass of mesoderm increased size, abnormal	WT + MO1-prr7	Fig. s6 from Kim et al., 2017
margin GFP expression increased amount, abnormal	w25Tg + MO1-prr7	Fig. s7 from Kim et al., 2017
neuroectoderm anterior region six3b expression decreased distribution, abnormal	WT + MO1-prr7	Fig. 4 from Kim et al., 2017
neuroectoderm posterior region hoxb1b expression increased distribution, abnormal	WT + MO1-prr7	Fig. 4 from Kim et al., 2017
optic primordium zic1 expression decreased distribution, abnormal	WT + MO1-prr7	Fig. s6 from Kim et al., 2017
optic vesicle rx1 expression decreased distribution, abnormal	WT + MO1-prr7	Fig. s6 from Kim et al., 2017
segmental plate tbx16 expression increased distribution, abnormal	WT + MO1-prr7	Fig. 4 from Kim et al., 2017
whole organism ventralized, abnormal	WT + MO11-tp53 + MO1-prr7	Fig. s6 from Kim et al., 2017

Phenotype of all Fish created by or utilizing MO1-prr7

Phenotype	Fish	Conditions	Figures
intermediate cell mass of mesoderm increased size, abnormal	WT + MO1-prr7	standard conditions	Fig. s6 from Kim et al., 2017
neuroectoderm anterior region six3b expression decreased distribution, abnormal	WT + MO1-prr7	control	Fig. 4 from Kim et al., 2017
optic primordium zic1 expression decreased distribution, abnormal	WT + MO1-prr7	control	Fig. s6 from Kim et al., 2017
head decreased size, abnormal	WT + MO1-prr7	standard conditions	Fig. s6 from Kim et al., 2017
neuroectoderm posterior region hoxb1b expression increased distribution, abnormal	WT + MO1-prr7	control	Fig. 4 from Kim et al., 2017
eye decreased size, abnormal	WT + MO1-prr7	standard conditions	Fig. s6 from Kim et al., 2017
segmental plate tbx16 expression increased distribution, abnormal	WT + MO1-prr7	control	Fig. 4 from Kim et al., 2017
whole organism ventralized, abnormal	WT + MO1-prr7	standard conditions	Fig. s6 from Kim et al., 2017
optic vesicle rx1 expression decreased distribution, abnormal	WT + MO1-prr7	control	Fig. s6 from Kim et al., 2017
head decreased size, abnormal	WT + MO11-tp53 + MO1-prr7	standard conditions	Fig. s6 from Kim et al., 2017
eye decreased size, abnormal	WT + MO11-tp53 + MO1-prr7	standard conditions	Fig. s6 from Kim et al., 2017
whole organism ventralized, abnormal	WT + MO11-tp53 + MO1-prr7	standard conditions	Fig. s6 from Kim et al., 2017
margin GFP expression increased amount, abnormal	w25Tg + MO1-prr7	standard conditions	Fig. s7 from Kim et al., 2017

Citations