Morpholino
MO1-srsf5a
- ID
- ZDB-MRPHLNO-180205-1
- Name
- MO1-srsf5a
- Previous Names
-
- sMOsrsf5a (1)
- Target
- Sequence
-
5' - GGATTCAGTCTCACCTCTCACTGCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-srsf5a
Expressed Gene | Anatomy | Figures |
---|---|---|
pax6b |
Fig. 1 ![]() |
|
srsf1b |
Fig. 2 ![]() |
|
srsf2b |
Fig. 2 ![]() |
|
srsf3a |
Fig. 2 ![]() |
|
srsf5a |
Fig. 2 ![]() |
|
srsf5b |
Fig. 2 ![]() |
|
srsf6a |
Fig. 2 ![]() |
Phenotype
Phenotype resulting from MO1-srsf5a
Phenotype of all Fish created by or utilizing MO1-srsf5a
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
retinal inner nuclear layer disorganized, abnormal | WT + MO1-srsf5a | control |
Fig. 1 ![]() |
pericardium edematous, abnormal | WT + MO1-srsf5a | control |
Fig. 1 ![]() |
brain cell death increased occurrence, abnormal | WT + MO1-srsf5a | control |
Fig. 1 ![]() |
caudal fin bent, abnormal | WT + MO1-srsf5a | control |
Fig. 1 ![]() |
retina cell disorganized, abnormal | WT + MO1-srsf5a | control |
Fig. 1 ![]() |
brain necrotic, abnormal | WT + MO1-srsf5a | control |
Fig. 1 ![]() |
retinal ganglion cell layer disorganized, abnormal | WT + MO1-srsf5a | control |
Fig. 1 ![]() |
eye cell death increased occurrence, abnormal | WT + MO1-srsf5a | control |
Fig. 1 ![]() |
eye necrotic, abnormal | WT + MO1-srsf5a | control |
Fig. 1 ![]() |
Citations