Morpholino

MO3-apc

ID
ZDB-MRPHLNO-180130-10
Name
MO3-apc
Previous Names
None
Target
Sequence
5' - CCAAGCCAACAGCTTCTCACCTTTA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-apc
Expressed Gene Anatomy Figures
cs Fig. 4 with image from Sandoval et al., 2017
fabp2 Fig. 3 with image from Sandoval et al., 2017
mpc1 Fig. 1 with image from Sandoval et al., 2017
mpc2b Fig. 1 with image from Sandoval et al., 2017
pdha1a Fig. 4 with image from Sandoval et al., 2017
pdk1 Fig. 4 with image from Sandoval et al., 2017
pkma Fig. 4 with image from Sandoval et al., 2017
Phenotype
Phenotype resulting from MO3-apc
Phenotype Fish Figures
aerobic respiration decreased rate, abnormal TU + MO3-apc Fig. 4 with image from Sandoval et al., 2017
gut mpc1 expression decreased amount, abnormal TU + MO3-apc Fig. 1 with image from Sandoval et al., 2017
gut fabp2 expression decreased amount, abnormal TU + MO3-apc Fig. 3 with image from Sandoval et al., 2017
head mpc1 expression decreased amount, abnormal TU + MO3-apc Fig. 1 with image from Sandoval et al., 2017
trunk mpc2b expression decreased amount, abnormal TU + MO3-apc Fig. 1 with image from Sandoval et al., 2017
whole organism pdha1a expression decreased amount, abnormal TU + MO3-apc Fig. 4 with image from Sandoval et al., 2017
whole organism pdk1 expression decreased amount, abnormal TU + MO3-apc Fig. 4 with image from Sandoval et al., 2017
whole organism cs expression decreased amount, abnormal TU + MO3-apc Fig. 4 with image from Sandoval et al., 2017
whole organism mpc2b expression decreased amount, abnormal TU + MO3-apc Fig. 1 with image from Sandoval et al., 2017
whole organism mpc1 expression decreased amount, abnormal TU + MO3-apc Fig. 1 with image from Sandoval et al., 2017
whole organism pkma expression increased amount, abnormal TU + MO3-apc Fig. 4 with image from Sandoval et al., 2017
whole organism triglyceride decreased amount, abnormal TU + MO3-apc Fig. 4 with image from Sandoval et al., 2017
Phenotype of all Fish created by or utilizing MO3-apc
Phenotype Fish Conditions Figures
whole organism pdk1 expression decreased amount, abnormal TU + MO3-apc standard conditions Fig. 4 with image from Sandoval et al., 2017
whole organism mpc2b expression decreased amount, abnormal TU + MO3-apc standard conditions Fig. 1 with image from Sandoval et al., 2017
whole organism triglyceride decreased amount, abnormal TU + MO3-apc standard conditions Fig. 4 with image from Sandoval et al., 2017
whole organism cs expression decreased amount, abnormal TU + MO3-apc standard conditions Fig. 4 with image from Sandoval et al., 2017
whole organism pdha1a expression decreased amount, abnormal TU + MO3-apc standard conditions Fig. 4 with image from Sandoval et al., 2017
whole organism pkma expression increased amount, abnormal TU + MO3-apc standard conditions Fig. 4 with image from Sandoval et al., 2017
gut fabp2 expression decreased amount, abnormal TU + MO3-apc standard conditions Fig. 3 with image from Sandoval et al., 2017
head mpc1 expression decreased amount, abnormal TU + MO3-apc standard conditions Fig. 1 with image from Sandoval et al., 2017
trunk mpc2b expression decreased amount, abnormal TU + MO3-apc standard conditions Fig. 1 with image from Sandoval et al., 2017
aerobic respiration decreased rate, abnormal TU + MO3-apc standard conditions Fig. 4 with image from Sandoval et al., 2017
gut mpc1 expression decreased amount, abnormal TU + MO3-apc standard conditions Fig. 1 with image from Sandoval et al., 2017
whole organism mpc1 expression decreased amount, abnormal TU + MO3-apc standard conditions Fig. 1 with image from Sandoval et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.