Morpholino

MO2-ftr82

ID
ZDB-MRPHLNO-180108-2
Name
MO2-ftr82
Previous Names
None
Target
Sequence
5' - GCGCTATGTTTTCCTTACCTGTTTT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ftr82
Expressed Gene Anatomy Figures
efnb2a Fig. 6 with image from Chang et al., 2017
flt4 Fig. 6 with image from Chang et al., 2017
ftr82 Fig. 2 with image from Chang et al., 2017
gata6 Fig. S2 with image from Chang et al., 2017
kdrl Fig. 6 with image from Chang et al., 2017
mrc1a Fig. 6 with image from Chang et al., 2017
myl7 Fig. S2 with image from Chang et al., 2017
myod1 Fig. S2 with image from Chang et al., 2017
shha Fig. S2 with image from Chang et al., 2017
sox3 Fig. S2 with image from Chang et al., 2017
stab2 Fig. 6 with image from Chang et al., 2017
Phenotype
Phenotype resulting from MO2-ftr82
Phenotype Fish Figures
angiogenesis disrupted, abnormal la116Tg + MO2-ftr82 Fig. 2 with image from Chang et al., 2017
artery efnb2a expression decreased amount, abnormal WT + MO2-ftr82 Fig. 6 with image from Chang et al., 2017
blood increased accumulation caudal vein plexus, abnormal y1Tg + MO2-ftr82 Fig. 3 with image from Chang et al., 2017
blood circulation disrupted, abnormal y1Tg + MO2-ftr82 Fig. 3 with image from Chang et al., 2017
blood vessel development decreased process quality, abnormal la116Tg + MO2-ftr82 Fig. 2 with image from Chang et al., 2017
brain edematous, abnormal y1Tg + MO2-ftr82 Fig. 3 with image from Chang et al., 2017
caudal vein plexus flt4 expression decreased amount, abnormal WT + MO2-ftr82 Fig. 6 with image from Chang et al., 2017
caudal vein plexus mrc1a expression decreased amount, abnormal WT + MO2-ftr82 Fig. 6 with image from Chang et al., 2017
caudal vein plexus morphology, abnormal la116Tg + MO2-ftr82 Fig. 2 with image from Chang et al., 2017
caudal vein plexus sprouting angiogenesis decreased occurrence, abnormal la116Tg + MO2-ftr82 Fig. 2 with image from Chang et al., 2017
endothelial cell migration disrupted, abnormal la116Tg + MO2-ftr82 Fig. 5 with image from Chang et al., 2017
epidermis apoptotic process increased occurrence, abnormal WT + MO2-ftr82 Fig. 5 with image from Chang et al., 2017
intersegmental vessel flt4 expression decreased amount, abnormal WT + MO2-ftr82 Fig. 6 with image from Chang et al., 2017
intersegmental vessel decreased length, abnormal la116Tg + MO2-ftr82 Fig. 2 with image,  Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image from Chang et al., 2017
intersegmental vessel morphology, abnormal la116Tg + MO2-ftr82 Fig. 2 with image,  Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image from Chang et al., 2017
intersegmental vessel endothelial cell decreased amount, abnormal ci5Tg; y7Tg + MO2-ftr82 Fig. 5 with image from Chang et al., 2017
lymphangioblast cord absent, abnormal y1Tg + MO2-ftr82 Fig. 3 with image from Chang et al., 2017
pericardium edematous, abnormal y1Tg + MO2-ftr82 Fig. 3 with image from Chang et al., 2017
posterior cardinal vein flt4 expression decreased amount, abnormal WT + MO2-ftr82 Fig. 6 with image from Chang et al., 2017
posterior cardinal vein mrc1a expression decreased amount, abnormal WT + MO2-ftr82 Fig. 6 with image from Chang et al., 2017
vasculature kdrl expression decreased amount, abnormal WT + MO2-ftr82 Fig. 6 with image from Chang et al., 2017
vasculature stab2 expression decreased amount, abnormal WT + MO2-ftr82 Fig. 6 with image from Chang et al., 2017
whole organism kdrl expression decreased amount, abnormal WT + MO2-ftr82 Fig. 6 with image from Chang et al., 2017
whole organism efnb2a expression decreased amount, abnormal WT + MO2-ftr82 Fig. 6 with image from Chang et al., 2017
whole organism flt4 expression decreased amount, abnormal WT + MO2-ftr82 Fig. 6 with image from Chang et al., 2017
whole organism mrc1a expression decreased amount, abnormal WT + MO2-ftr82 Fig. 6 with image from Chang et al., 2017
whole organism ftr82 expression decreased amount, abnormal la116Tg + MO2-ftr82 Fig. 2 with image from Chang et al., 2017
Phenotype of all Fish created by or utilizing MO2-ftr82
Phenotype Fish Conditions Figures
caudal vein plexus flt4 expression decreased amount, abnormal WT + MO2-ftr82 standard conditions Fig. 6 with image from Chang et al., 2017
epidermis apoptotic process increased occurrence, abnormal WT + MO2-ftr82 standard conditions Fig. 5 with image from Chang et al., 2017
whole organism mrc1a expression decreased amount, abnormal WT + MO2-ftr82 standard conditions Fig. 6 with image from Chang et al., 2017
posterior cardinal vein flt4 expression decreased amount, abnormal WT + MO2-ftr82 standard conditions Fig. 6 with image from Chang et al., 2017
whole organism efnb2a expression decreased amount, abnormal WT + MO2-ftr82 standard conditions Fig. 6 with image from Chang et al., 2017
vasculature stab2 expression decreased amount, abnormal WT + MO2-ftr82 standard conditions Fig. 6 with image from Chang et al., 2017
intersegmental vessel flt4 expression decreased amount, abnormal WT + MO2-ftr82 standard conditions Fig. 6 with image from Chang et al., 2017
whole organism kdrl expression decreased amount, abnormal WT + MO2-ftr82 standard conditions Fig. 6 with image from Chang et al., 2017
vasculature kdrl expression decreased amount, abnormal WT + MO2-ftr82 standard conditions Fig. 6 with image from Chang et al., 2017
whole organism flt4 expression decreased amount, abnormal WT + MO2-ftr82 standard conditions Fig. 6 with image from Chang et al., 2017
posterior cardinal vein mrc1a expression decreased amount, abnormal WT + MO2-ftr82 standard conditions Fig. 6 with image from Chang et al., 2017
artery efnb2a expression decreased amount, abnormal WT + MO2-ftr82 standard conditions Fig. 6 with image from Chang et al., 2017
caudal vein plexus mrc1a expression decreased amount, abnormal WT + MO2-ftr82 standard conditions Fig. 6 with image from Chang et al., 2017
intersegmental vessel morphology, abnormal la116Tg + MO2-ftr82 standard conditions Fig. 2 with image,  Fig. 5 with image from Chang et al., 2017
endothelial cell migration disrupted, abnormal la116Tg + MO2-ftr82 standard conditions Fig. 5 with image from Chang et al., 2017
angiogenesis disrupted, abnormal la116Tg + MO2-ftr82 standard conditions Fig. 2 with image from Chang et al., 2017
whole organism ftr82 expression decreased amount, abnormal la116Tg + MO2-ftr82 standard conditions Fig. 2 with image from Chang et al., 2017
intersegmental vessel decreased length, abnormal la116Tg + MO2-ftr82 standard conditions Fig. 2 with image,  Fig. 5 with image from Chang et al., 2017
blood vessel development decreased process quality, abnormal la116Tg + MO2-ftr82 standard conditions Fig. 2 with image from Chang et al., 2017
caudal vein plexus morphology, abnormal la116Tg + MO2-ftr82 standard conditions Fig. 2 with image from Chang et al., 2017
caudal vein plexus sprouting angiogenesis decreased occurrence, abnormal la116Tg + MO2-ftr82 standard conditions Fig. 2 with image from Chang et al., 2017
intersegmental vessel morphology, abnormal y1Tg + MO2-ftr82 standard conditions Fig. 3 with image,  Fig. 4 with image from Chang et al., 2017
blood increased accumulation caudal vein plexus, abnormal y1Tg + MO2-ftr82 standard conditions Fig. 3 with image from Chang et al., 2017
intersegmental vessel decreased length, abnormal y1Tg + MO2-ftr82 standard conditions Fig. 3 with image,  Fig. 4 with image from Chang et al., 2017
lymphangioblast cord absent, abnormal y1Tg + MO2-ftr82 standard conditions Fig. 3 with image from Chang et al., 2017
blood circulation disrupted, abnormal y1Tg + MO2-ftr82 standard conditions Fig. 3 with image from Chang et al., 2017
brain edematous, abnormal y1Tg + MO2-ftr82 standard conditions Fig. 3 with image from Chang et al., 2017
pericardium edematous, abnormal y1Tg + MO2-ftr82 standard conditions Fig. 3 with image from Chang et al., 2017
intersegmental vessel morphology, abnormal ci5Tg; y7Tg + MO2-ftr82 standard conditions Fig. 5 with image from Chang et al., 2017
intersegmental vessel endothelial cell decreased amount, abnormal ci5Tg; y7Tg + MO2-ftr82 standard conditions Fig. 5 with image from Chang et al., 2017
intersegmental vessel decreased length, abnormal ci5Tg; y7Tg + MO2-ftr82 standard conditions Fig. 5 with image from Chang et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.