Morpholino

MO1-si:ch1073-384e4.1

ID
ZDB-MRPHLNO-170814-1
Name
MO1-si:ch1073-384e4.1
Previous Names
  • slincR-MO (1)
Target
Sequence
5' - GACCTAAACTCGACCTTACCAGATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
splice blocking MO targeting the exon/intron boundary of slincR exon 1 ; reference: Garcia et al. (2017) PubMed:28385905, ZDB-PUB-170408-7
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-si:ch1073-384e4.1
Phenotype
Phenotype resulting from MO1-si:ch1073-384e4.1
Phenotype of all Fish created by or utilizing MO1-si:ch1073-384e4.1
Phenotype Fish Conditions Figures
mandibular arch skeleton morphology, abnormal SPF 5-D + MO1-si:ch1073-384e4.1 chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4 with image from Garcia et al., 2018
head hemorrhagic, ameliorated SPF 5-D + MO1-si:ch1073-384e4.1 chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 5 with image from Garcia et al., 2018
splanchnocranium joint morphology, abnormal SPF 5-D + MO1-si:ch1073-384e4.1 chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4 with image from Garcia et al., 2018
whole organism sox9b expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 chemical treatment by environment: dimethyl sulfoxide, chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4 with image from Garcia et al., 2017
whole organism sfrp2 expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 standard conditions Fig. 5 with image from Garcia et al., 2017
hindbrain notch3 expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 standard conditions Fig. 5 with image from Garcia et al., 2017
midbrain notch3 expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 standard conditions Fig. 5 with image from Garcia et al., 2017
pectoral fin bud notch3 expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 standard conditions Fig. 5 with image from Garcia et al., 2017
whole organism adamts3 expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 standard conditions Fig. 5 with image from Garcia et al., 2017
midbrain sox9b expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 chemical treatment by environment: dimethyl sulfoxide Fig. 4 with image from Garcia et al., 2017
otic vesicle sox9b expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 chemical treatment by environment: dimethyl sulfoxide, chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4 with image from Garcia et al., 2017
whole organism notch3 expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 standard conditions Fig. 5 with image from Garcia et al., 2017
somite adamts3 expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 standard conditions Fig. 5 with image from Garcia et al., 2017
whole organism si:ch1073-384e4.1 expression decreased amount, abnormal WT + MO1-si:ch1073-384e4.1 chemical treatment by environment: dimethyl sulfoxide, chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4 with image from Garcia et al., 2017
pharyngeal arch sox9b expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 chemical treatment by environment: dimethyl sulfoxide, chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4 with image from Garcia et al., 2017
whole organism fgfr3 expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 standard conditions Fig. 5 with image from Garcia et al., 2017
whole organism sox9b expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 chemical treatment by environment: dimethyl sulfoxide Fig. 4 with image from Garcia et al., 2017
eye notch3 expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 standard conditions Fig. 5 with image from Garcia et al., 2017
whole organism fabp2 expression decreased amount, abnormal WT + MO1-si:ch1073-384e4.1 standard conditions Fig. 5 with image from Garcia et al., 2017
whole organism sox9b expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 standard conditions Fig. 5 with image from Garcia et al., 2017
whole organism si:ch1073-384e4.1 expression decreased amount, abnormal WT + MO1-si:ch1073-384e4.1 chemical treatment by environment: dimethyl sulfoxide Fig. 4 with image from Garcia et al., 2017
otic vesicle sox9b expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 chemical treatment by environment: dimethyl sulfoxide Fig. 4 with image from Garcia et al., 2017
eye sox9b expression increased amount, abnormal WT + MO1-si:ch1073-384e4.1 chemical treatment by environment: dimethyl sulfoxide, chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4 with image from Garcia et al., 2017
locomotory behavior decreased occurrence, abnormal WT + MO1-si:ch1073-384e4.1 standard conditions Fig. 6 with image from Garcia et al., 2017
Citations