Morpholino

MO3-setb

ID
ZDB-MRPHLNO-170223-2
Name
MO3-setb
Previous Names
  • E3I3 (1)
Target
Sequence
5' - TGAGTTATATTCCCTCTCACCTTGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-setb
Expressed Gene Anatomy Figures
akt3b Fig. 8 from Serifi et al., 2016
atoh1a Fig. 8 from Serifi et al., 2016
atoh1b Fig. 8 from Serifi et al., 2016
atoh7 Fig. 8 from Serifi et al., 2016
cdkn1a Fig. 8 from Serifi et al., 2016
crx Fig. 8 from Serifi et al., 2016
cryaa Fig. 8 from Serifi et al., 2016
foxi1 Fig. 8 from Serifi et al., 2016
foxj1a Fig. 8 from Serifi et al., 2016
junba Fig. 8 from Serifi et al., 2016
neurod1 Fig. 8 from Serifi et al., 2016
neurod4 Fig. 8 from Serifi et al., 2016
oc90 Fig. 8 from Serifi et al., 2016
optc Fig. 8 from Serifi et al., 2016
otpa Fig. 8 from Serifi et al., 2016
otpb Fig. 8 from Serifi et al., 2016
ovol1a Fig. 8 from Serifi et al., 2016
six7 Fig. 8 from Serifi et al., 2016
slc12a3 Fig. 8 from Serifi et al., 2016
Phenotype
Phenotype resulting from MO3-setb
Phenotype Fish Figures
brain mCherry expression decreased amount, abnormal ia10Tg + MO3-setb Figure 2 with image from Serifi et al., 2021
eye decreased size, abnormal WT + MO3-setb Fig. 5 from Serifi et al., 2016
eye deformed, abnormal WT + MO3-setb Fig. 5 from Serifi et al., 2016
floor plate mCherry expression decreased amount, abnormal ia10Tg + MO3-setb Figure 2 with image from Serifi et al., 2021
head Ab1-set labeling decreased distribution, abnormal WT + MO3-setb Fig. 5 from Serifi et al., 2016
head decreased size, abnormal WT + MO3-setb Fig. 5 from Serifi et al., 2016
head shape, abnormal WT + MO3-setb Fig. 5 from Serifi et al., 2016
lateral line system development disrupted, abnormal WT + MO3-setb Fig. 7 from Serifi et al., 2016
muscle pioneer mCherry expression decreased amount, abnormal ia10Tg + MO3-setb Figure 2 with image from Serifi et al., 2021
myotome medial region mCherry expression decreased amount, abnormal ia10Tg + MO3-setb Figure 2 with image from Serifi et al., 2021
myotome smoothened signaling pathway decreased process quality, abnormal ia10Tg + MO3-setb Figure 2 with image from Serifi et al., 2021
myotome development decreased process quality, abnormal ia10Tg + MO3-setb Figure 2 with image from Serifi et al., 2021
neuromast decreased amount, abnormal WT + MO3-setb Fig. 7 from Serifi et al., 2016
post-vent region curved, abnormal WT + MO3-setb Fig. 5 from Serifi et al., 2016
post-vent region Ab1-set labeling decreased distribution, abnormal WT + MO3-setb Fig. 5 from Serifi et al., 2016
trunk bent, abnormal WT + MO3-setb Fig. 5 from Serifi et al., 2016
trunk Ab1-set labeling decreased distribution, abnormal WT + MO3-setb Fig. 5 from Serifi et al., 2016
trunk slow muscle cell mCherry expression decreased amount, abnormal ia10Tg + MO3-setb Figure 2 with image from Serifi et al., 2021
whole organism otpb expression decreased amount, abnormal WT + MO3-setb Fig. 8 from Serifi et al., 2016
whole organism neurod4 expression decreased amount, abnormal WT + MO3-setb Fig. 8 from Serifi et al., 2016
whole organism Ab2-set labeling decreased amount, abnormal WT + MO3-setb Fig. 5 from Serifi et al., 2016
whole organism neurod1 expression decreased amount, abnormal WT + MO3-setb Fig. 8 from Serifi et al., 2016
whole organism atoh7 expression decreased amount, abnormal WT + MO3-setb Fig. 8 from Serifi et al., 2016
whole organism six7 expression decreased amount, abnormal WT + MO3-setb Fig. 8 from Serifi et al., 2016
whole organism crx expression decreased amount, abnormal WT + MO3-setb Fig. 8 from Serifi et al., 2016
whole organism akt3b expression decreased amount, abnormal WT + MO3-setb Fig. 8 from Serifi et al., 2016
whole organism otpa expression decreased amount, abnormal WT + MO3-setb Fig. 8 from Serifi et al., 2016
whole organism oc90 expression increased amount, abnormal WT + MO3-setb Fig. 8 from Serifi et al., 2016
whole organism atoh1a expression increased amount, abnormal WT + MO3-setb Fig. 8 from Serifi et al., 2016
whole organism junba expression increased amount, abnormal WT + MO3-setb Fig. 8 from Serifi et al., 2016
whole organism foxj1a expression increased amount, abnormal WT + MO3-setb Fig. 8 from Serifi et al., 2016
whole organism cdkn1a expression increased amount, abnormal WT + MO3-setb Fig. 8 from Serifi et al., 2016
whole organism anterior-posterior axis decreased length, abnormal WT + MO3-setb Fig. 5 from Serifi et al., 2016
Phenotype of all Fish created by or utilizing MO3-setb
Phenotype Fish Conditions Figures
post-vent region curved, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
whole organism foxj1a expression increased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
trunk bent, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
whole organism six7 expression decreased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
whole organism crx expression decreased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
head shape, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
trunk Ab1-set labeling decreased distribution, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
eye deformed, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
whole organism Ab2-set labeling decreased amount, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
whole organism oc90 expression increased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
head Ab1-set labeling decreased distribution, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
whole organism cdkn1a expression increased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
whole organism junba expression increased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
whole organism anterior-posterior axis decreased length, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
whole organism neurod1 expression decreased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
lateral line system development disrupted, abnormal WT + MO3-setb standard conditions Fig. 7 from Serifi et al., 2016
whole organism otpb expression decreased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
whole organism otpa expression decreased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
post-vent region Ab1-set labeling decreased distribution, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
whole organism atoh7 expression decreased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
head decreased size, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
eye decreased size, abnormal WT + MO3-setb standard conditions Fig. 5 from Serifi et al., 2016
whole organism akt3b expression decreased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
neuromast decreased amount, abnormal WT + MO3-setb standard conditions Fig. 7 from Serifi et al., 2016
whole organism atoh1a expression increased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
whole organism neurod4 expression decreased amount, abnormal WT + MO3-setb standard conditions Fig. 8 from Serifi et al., 2016
floor plate mCherry expression decreased amount, abnormal ia10Tg + MO3-setb standard conditions Figure 2 with image from Serifi et al., 2021
brain mCherry expression decreased amount, abnormal ia10Tg + MO3-setb standard conditions Figure 2 with image from Serifi et al., 2021
muscle pioneer mCherry expression decreased amount, abnormal ia10Tg + MO3-setb standard conditions Figure 2 with image from Serifi et al., 2021
myotome medial region mCherry expression decreased amount, abnormal ia10Tg + MO3-setb standard conditions Figure 2 with image from Serifi et al., 2021
myotome smoothened signaling pathway decreased process quality, abnormal ia10Tg + MO3-setb standard conditions Figure 2 with image from Serifi et al., 2021
myotome development decreased process quality, abnormal ia10Tg + MO3-setb standard conditions Figure 2 with image from Serifi et al., 2021
trunk slow muscle cell mCherry expression decreased amount, abnormal ia10Tg + MO3-setb standard conditions Figure 2 with image from Serifi et al., 2021
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.