Morpholino

MO2-shox

ID
ZDB-MRPHLNO-170124-1
Name
MO2-shox
Previous Names
None
Target
Sequence
5' - CGCATGGAAGAATGGGAGCTTACCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-shox
Expressed Gene Anatomy Figures
col2a1a Fig. 4 with image from Montalbano et al., 2016
Phenotype
Phenotype resulting from MO2-shox
Phenotype Fish Figures
pectoral fin decreased size, abnormal AB/TL + MO2-shox Fig. 4 with image from Montalbano et al., 2016
pectoral fin chondrocyte col2a1a expression decreased amount, abnormal AB/TL + MO2-shox Fig. 4 with image from Montalbano et al., 2016
Phenotype of all Fish created by or utilizing MO2-shox
Phenotype Fish Conditions Figures
pectoral fin decreased size, abnormal AB/TL + MO2-shox standard conditions Fig. 4 with image from Montalbano et al., 2016
pectoral fin chondrocyte col2a1a expression decreased amount, abnormal AB/TL + MO2-shox standard conditions Fig. 4 with image from Montalbano et al., 2016
fin rasd1 expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
whole organism her15.1 expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
fin bmp4 expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
fin cdkn1a expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
fin sox18 expression decreased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
whole organism shox2 expression decreased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
heart sox8a expression decreased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
fin sox6 expression decreased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
whole organism cyp26c1 expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
fin cdkn1ca expression decreased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
head cdkn1a expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
whole organism rasd1 expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
fin her15.1 expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
fin nppa expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
heart cdkn1a expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
whole organism cdkn1a expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
fin krt17 expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
head cyp26c1 expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
fin vgf expression decreased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
fin nppc expression decreased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
fin cyp26c1 expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
fin cyp26b1 expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
fin sox5 expression decreased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
heart cyp26c1 expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
heart bmp4 expression increased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
fin sox8a expression decreased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
fin shox2 expression decreased amount, abnormal f1Tg + MO2-shox + MO3-shox standard conditions Fig. 2 from Hoffmann et al., 2021
whole organism shox expression decreased amount, abnormal AB/TL + MO2-shox + MO4-cyp26c1 standard conditions Fig. 6 with image from Montalbano et al., 2016
pectoral fin decreased size, abnormal AB/TL + MO2-shox + MO4-cyp26c1 standard conditions Fig. 6 with image from Montalbano et al., 2016
pectoral fin development disrupted, abnormal AB/TL + MO2-shox + MO4-cyp26c1 standard conditions Fig. 6 with image from Montalbano et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.