Morpholino

MO1-dre-mir-19b

ID
ZDB-MRPHLNO-161222-7
Name
MO1-dre-mir-19b
Previous Names
  • MO1-mir19b
Target
Sequence
5' - TCAGTTTTGCATGGATTTGCACAGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dre-mir-19b
Expressed Gene Anatomy Figures
dre-mir-19a Fig. 3 with image from Benz et al., 2016
dre-mir-19b Fig. 3 with image from Benz et al., 2016
mir19c Fig. 3 with image from Benz et al., 2016
mir19d Fig. 3 with image from Benz et al., 2016
mir363 Fig. 3 with image from Benz et al., 2016
Phenotype
Phenotype resulting from MO1-dre-mir-19b
Phenotype Fish Figures
cardiac ventricle cardiac muscle contraction decreased magnitude, abnormal WT + MO1-dre-mir-19b Fig. 3 with image from Benz et al., 2016
eye decreased size, abnormal WT + MO1-dre-mir-19b Fig. 3 with image from Benz et al., 2016
heart contraction decreased frequency, abnormal WT + MO1-dre-mir-19b Fig. 3 with image from Benz et al., 2016
retina development in camera-type eye decreased process quality, abnormal WT + MO1-dre-mir-19b Fig. 3 with image from Benz et al., 2016
whole organism mir19c expression decreased amount, abnormal WT + MO1-dre-mir-19b Fig. 3 with image from Benz et al., 2016
whole organism dre-mir-19b expression decreased amount, abnormal WT + MO1-dre-mir-19b Fig. 3 with image from Benz et al., 2016
whole organism mir19d expression decreased amount, abnormal WT + MO1-dre-mir-19b Fig. 3 with image from Benz et al., 2016
whole organism dre-mir-19a expression decreased amount, abnormal WT + MO1-dre-mir-19b Fig. 3 with image from Benz et al., 2016
whole organism mir363 expression decreased amount, abnormal WT + MO1-dre-mir-19b Fig. 3 with image from Benz et al., 2016
Phenotype of all Fish created by or utilizing MO1-dre-mir-19b
Phenotype Fish Conditions Figures
whole organism mir19d expression decreased amount, abnormal WT + MO1-dre-mir-19b standard conditions Fig. 3 with image from Benz et al., 2016
eye decreased size, abnormal WT + MO1-dre-mir-19b standard conditions Fig. 3 with image from Benz et al., 2016
cardiac ventricle cardiac muscle contraction decreased magnitude, abnormal WT + MO1-dre-mir-19b standard conditions Fig. 3 with image from Benz et al., 2016
whole organism mir363 expression decreased amount, abnormal WT + MO1-dre-mir-19b standard conditions Fig. 3 with image from Benz et al., 2016
heart contraction decreased frequency, abnormal WT + MO1-dre-mir-19b standard conditions Fig. 3 with image from Benz et al., 2016
retina development in camera-type eye decreased process quality, abnormal WT + MO1-dre-mir-19b standard conditions Fig. 3 with image from Benz et al., 2016
whole organism dre-mir-19b expression decreased amount, abnormal WT + MO1-dre-mir-19b standard conditions Fig. 3 with image from Benz et al., 2016
whole organism dre-mir-19a expression decreased amount, abnormal WT + MO1-dre-mir-19b standard conditions Fig. 3 with image from Benz et al., 2016
whole organism mir19c expression decreased amount, abnormal WT + MO1-dre-mir-19b standard conditions Fig. 3 with image from Benz et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.