Morpholino

MO3-nolc1

ID
ZDB-MRPHLNO-161205-3
Name
MO3-nolc1
Previous Names
None
Target
Sequence
5' - TAGGAACCGTGCTGTCCTCCGCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-nolc1
Expressed Gene Anatomy Figures
ccng1 Fig. 2 with image from de Peralta et al., 2016
cnbpa Fig. 1,  Fig. 4 from Rosas et al., 2019
Fig. 4 with image from de Peralta et al., 2016
nolc1 Fig. 1 from Rosas et al., 2019
pmaip1 Fig. 2 with image from de Peralta et al., 2016
tp53inp1 Fig. 2 with image from de Peralta et al., 2016
Phenotype
Phenotype resulting from MO3-nolc1
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal WT + MO3-nolc1 Fig. 2 with image from de Peralta et al., 2016
apoptotic process process quality, ameliorated WT + MO3-nolc1 + MO4-tp53 Fig. 2 with image from de Peralta et al., 2016
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal WT + MO3-nolc1 Fig. 1,  Fig. 3 from Rosas et al., 2019
cranial cartilage morphology, abnormal WT + MO3-nolc1 Fig. 1 with image,  Fig. 2 with image from de Peralta et al., 2016
cranial cartilage morphology, ameliorated WT + MO3-nolc1 + MO4-tp53 Fig. 2 with image from de Peralta et al., 2016
cranium decreased length, abnormal WT + MO3-nolc1 Fig. 1,  Fig. 3 from Rosas et al., 2019
embryonic cranial skeleton morphogenesis disrupted, abnormal WT + MO3-nolc1 Fig. 1 with image,  Fig. 2 with image from de Peralta et al., 2016
embryonic cranial skeleton morphogenesis process quality, ameliorated WT + MO3-nolc1 + MO4-tp53 Fig. 2 with image from de Peralta et al., 2016
head apoptotic, abnormal WT + MO3-nolc1 Fig. 2 with image from de Peralta et al., 2016
head apoptotic process increased frequency, abnormal WT + MO3-nolc1 Fig. 5 from Rosas et al., 2019
hyosymplectic cartilage decreased length, abnormal WT + MO3-nolc1 Fig. 1,  Fig. 3 from Rosas et al., 2019
Meckel's cartilage increased angle to Meckel's cartilage, abnormal WT + MO3-nolc1 Fig. 1,  Fig. 3 from Rosas et al., 2019
palatoquadrate cartilage decreased length, abnormal WT + MO3-nolc1 Fig. 1,  Fig. 3 from Rosas et al., 2019
pharyngeal arch cartilage morphology, abnormal WT + MO3-nolc1 Fig. 2 from Rosas et al., 2019
ventral mandibular arch decreased width, abnormal WT + MO3-nolc1 Fig. 3 from Rosas et al., 2019
whole organism tp53inp1 expression amount, ameliorated WT + MO3-nolc1 + MO4-tp53 Fig. 2 with image from de Peralta et al., 2016
whole organism pmaip1 expression amount, ameliorated WT + MO3-nolc1 + MO4-tp53 Fig. 2 with image from de Peralta et al., 2016
whole organism cnbpa expression decreased amount, abnormal WT + MO3-nolc1 Fig. 1,  Fig. 4 from Rosas et al., 2019
Fig. 4 with image from de Peralta et al., 2016
whole organism nolc1 expression decreased amount, abnormal WT + MO3-nolc1 Fig. 1 from Rosas et al., 2019
whole organism pmaip1 expression increased amount, abnormal WT + MO3-nolc1 Fig. 2 with image from de Peralta et al., 2016
whole organism ccng1 expression increased amount, abnormal WT + MO3-nolc1 + MO4-tp53 Fig. 2 with image from de Peralta et al., 2016
whole organism tp53inp1 expression increased amount, abnormal WT + MO3-nolc1 Fig. 2 with image from de Peralta et al., 2016
whole organism reactive oxygen species increased amount, abnormal WT + MO3-nolc1 Fig. 5 from Rosas et al., 2019
Phenotype of all Fish created by or utilizing MO3-nolc1
Phenotype Fish Conditions Figures
cranial cartilage morphology, abnormal WT + MO3-nolc1 standard conditions Fig. 1 with image,  Fig. 2 with image from de Peralta et al., 2016
palatoquadrate cartilage decreased length, ameliorated WT + MO3-nolc1 chemical treatment: bortezomib Fig. 3 from Rosas et al., 2019
whole organism ccng1 expression increased amount, abnormal WT + MO3-nolc1 standard conditions Fig. 2 with image from de Peralta et al., 2016
whole organism nolc1 expression decreased amount, abnormal WT + MO3-nolc1 standard conditions Fig. 1 from Rosas et al., 2019
head apoptotic process increased frequency, abnormal WT + MO3-nolc1 control Fig. 5 from Rosas et al., 2019
pharyngeal arch cartilage morphology, abnormal WT + MO3-nolc1 control Fig. 2 from Rosas et al., 2019
whole organism cnbpa expression increased amount, abnormal WT + MO3-nolc1 chemical treatment: bortezomib Fig. 4 from Rosas et al., 2019
apoptotic process increased occurrence, abnormal WT + MO3-nolc1 standard conditions Fig. 2 with image from de Peralta et al., 2016
hyosymplectic cartilage decreased length, ameliorated WT + MO3-nolc1 chemical treatment: bortezomib Fig. 3 from Rosas et al., 2019
hyosymplectic cartilage decreased length, abnormal WT + MO3-nolc1 standard conditions Fig. 1,  Fig. 3 from Rosas et al., 2019
cranium decreased length, abnormal WT + MO3-nolc1 standard conditions Fig. 1,  Fig. 3 from Rosas et al., 2019
Meckel's cartilage increased angle to Meckel's cartilage, ameliorated WT + MO3-nolc1 chemical treatment by environment: N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal Fig. 3 from Rosas et al., 2019
hyosymplectic cartilage decreased length, ameliorated WT + MO3-nolc1 chemical treatment by environment: N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal Fig. 3 from Rosas et al., 2019
whole organism cnbpa expression increased amount, abnormal WT + MO3-nolc1 chemical treatment by environment: N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal Fig. 4 from Rosas et al., 2019
head apoptotic process increased frequency, ameliorated WT + MO3-nolc1 chemical treatment: bortezomib Fig. 5 from Rosas et al., 2019
palatoquadrate cartilage decreased length, ameliorated WT + MO3-nolc1 chemical treatment by environment: N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal Fig. 3 from Rosas et al., 2019
pharyngeal arch cartilage morphology, ameliorated WT + MO3-nolc1 chemical treatment: bortezomib Fig. 2 from Rosas et al., 2019
ventral mandibular arch decreased width, ameliorated WT + MO3-nolc1 chemical treatment by environment: N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal Fig. 3 from Rosas et al., 2019
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal WT + MO3-nolc1 chemical treatment by environment: N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal Fig. 3 from Rosas et al., 2019
pharyngeal arch cartilage morphology, ameliorated WT + MO3-nolc1 chemical treatment by environment: N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal Fig. 2 from Rosas et al., 2019
Meckel's cartilage increased angle to Meckel's cartilage, abnormal WT + MO3-nolc1 standard conditions Fig. 1,  Fig. 3 from Rosas et al., 2019
cranium decreased length, ameliorated WT + MO3-nolc1 chemical treatment by environment: N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal Fig. 3 from Rosas et al., 2019
ventral mandibular arch decreased width, ameliorated WT + MO3-nolc1 chemical treatment: bortezomib Fig. 3 from Rosas et al., 2019
whole organism reactive oxygen species increased amount, ameliorated WT + MO3-nolc1 chemical treatment: bortezomib Fig. 5 from Rosas et al., 2019
whole organism reactive oxygen species increased amount, ameliorated WT + MO3-nolc1 chemical treatment by environment: N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal Fig. 5 from Rosas et al., 2019
head apoptotic, abnormal WT + MO3-nolc1 standard conditions Fig. 2 with image from de Peralta et al., 2016
whole organism cnbpa expression decreased amount, abnormal WT + MO3-nolc1 control Fig. 1,  Fig. 4 from Rosas et al., 2019
Fig. 4 with image from de Peralta et al., 2016
head apoptotic process increased frequency, ameliorated WT + MO3-nolc1 chemical treatment by environment: N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal Fig. 5 from Rosas et al., 2019
embryonic cranial skeleton morphogenesis disrupted, abnormal WT + MO3-nolc1 standard conditions Fig. 1 with image,  Fig. 2 with image from de Peralta et al., 2016
whole organism pmaip1 expression increased amount, abnormal WT + MO3-nolc1 standard conditions Fig. 2 with image from de Peralta et al., 2016
whole organism reactive oxygen species increased amount, abnormal WT + MO3-nolc1 control Fig. 5 from Rosas et al., 2019
ceratohyal cartilage increased angle to ceratohyal cartilage, ameliorated WT + MO3-nolc1 chemical treatment: bortezomib Fig. 3 from Rosas et al., 2019
whole organism tp53inp1 expression increased amount, abnormal WT + MO3-nolc1 standard conditions Fig. 2 with image from de Peralta et al., 2016
palatoquadrate cartilage decreased length, abnormal WT + MO3-nolc1 standard conditions Fig. 1,  Fig. 3 from Rosas et al., 2019
ventral mandibular arch decreased width, abnormal WT + MO3-nolc1 control Fig. 3 from Rosas et al., 2019
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal WT + MO3-nolc1 standard conditions Fig. 1,  Fig. 3 from Rosas et al., 2019
Meckel's cartilage increased angle to Meckel's cartilage, ameliorated WT + MO3-nolc1 chemical treatment: bortezomib Fig. 3 from Rosas et al., 2019
whole organism ccng1 expression increased amount, abnormal WT + MO3-nolc1 + MO4-tp53 standard conditions Fig. 2 with image from de Peralta et al., 2016
embryonic cranial skeleton morphogenesis process quality, ameliorated WT + MO3-nolc1 + MO4-tp53 standard conditions Fig. 2 with image from de Peralta et al., 2016
cranial cartilage morphology, ameliorated WT + MO3-nolc1 + MO4-tp53 standard conditions Fig. 2 with image from de Peralta et al., 2016
apoptotic process process quality, ameliorated WT + MO3-nolc1 + MO4-tp53 standard conditions Fig. 2 with image from de Peralta et al., 2016
whole organism pmaip1 expression amount, ameliorated WT + MO3-nolc1 + MO4-tp53 standard conditions Fig. 2 with image from de Peralta et al., 2016
whole organism tp53inp1 expression amount, ameliorated WT + MO3-nolc1 + MO4-tp53 standard conditions Fig. 2 with image from de Peralta et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.