Morpholino

MO1-slc39a10

ID
ZDB-MRPHLNO-161018-1
Name
MO1-slc39a10
Previous Names
  • zip10 TB (1)
Target
Sequence
5' - TGGTATGTGTGTGAACTCTCATCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-slc39a10
Expressed Gene Anatomy Figures
cdh1 Fig. 5 with image from Taylor et al., 2016
slc39a6 Fig. 5 with image from Taylor et al., 2016
stat3 Fig. 5 with image from Taylor et al., 2016
Phenotype
Phenotype resulting from MO1-slc39a10
Phenotype Fish Figures
epiboly involved in gastrulation with mouth forming second delayed, abnormal WT + MO1-slc39a10 + MO4-tp53 Fig. 4 with image,  Fig. S2 with image from Taylor et al., 2016
epithelial to mesenchymal transition delayed, abnormal WT + MO1-slc39a10 + MO4-tp53 Fig. S2 with image from Taylor et al., 2016
eye malformed, abnormal WT + MO1-slc39a10 + MO4-tp53 Fig. S2 with image from Taylor et al., 2016
eye morphology, abnormal WT + MO1-slc39a10 + MO4-tp53 Fig. 4 with image from Taylor et al., 2016
hatching delayed, abnormal WT + MO1-slc39a10 + MO4-tp53 Fig. S2 with image from Taylor et al., 2016
head deformed, abnormal WT + MO1-slc39a10 + MO4-tp53 Fig. S2 with image from Taylor et al., 2016
head morphology, abnormal WT + MO1-slc39a10 + MO4-tp53 Fig. 4 with image from Taylor et al., 2016
heart malformed, abnormal WT + MO1-slc39a10 + MO4-tp53 Fig. 4 with image,  Fig. S2 with image from Taylor et al., 2016
pericardium edematous, abnormal WT + MO1-slc39a10 + MO4-tp53 Fig. 4 with image,  Fig. S2 with image from Taylor et al., 2016
post-vent region bent, abnormal WT + MO1-slc39a10 + MO4-tp53 Fig. 4 with image from Taylor et al., 2016
post-vent region curved, abnormal WT + MO1-slc39a10 + MO4-tp53 Fig. 4 with image,  Fig. S2 with image from Taylor et al., 2016
tail bud immature, abnormal WT + MO1-slc39a10 + MO4-tp53 Fig. 4 with image from Taylor et al., 2016
whole organism ab4-cdh1 labeling increased amount, abnormal WT + MO1-slc39a10 Fig. 5 with image from Taylor et al., 2016
whole organism slc39a6 expression increased amount, abnormal WT + MO1-slc39a10 Fig. 5 with image from Taylor et al., 2016
whole organism cdh1 expression increased amount, abnormal WT + MO1-slc39a10 Fig. 5 with image from Taylor et al., 2016
whole organism stat3 expression increased amount, abnormal WT + MO1-slc39a10 Fig. 5 with image from Taylor et al., 2016
whole organism dorsal-ventral axis shortened, abnormal WT + MO1-slc39a10 + MO4-tp53 Fig. 4 with image,  Fig. S2 with image from Taylor et al., 2016
Phenotype of all Fish created by or utilizing MO1-slc39a10
Phenotype Fish Conditions Figures
whole organism slc39a6 expression increased amount, abnormal WT + MO1-slc39a10 standard conditions Fig. 5 with image from Taylor et al., 2016
whole organism cdh1 expression increased amount, abnormal WT + MO1-slc39a10 standard conditions Fig. 5 with image from Taylor et al., 2016
whole organism ab4-cdh1 labeling increased amount, abnormal WT + MO1-slc39a10 standard conditions Fig. 5 with image from Taylor et al., 2016
whole organism stat3 expression increased amount, abnormal WT + MO1-slc39a10 standard conditions Fig. 5 with image from Taylor et al., 2016
head morphology, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. 4 with image from Taylor et al., 2016
eye morphology, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. 4 with image from Taylor et al., 2016
eye malformed, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. S2 with image from Taylor et al., 2016
head deformed, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. S2 with image from Taylor et al., 2016
heart malformed, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. 4 with image,  Fig. S2 with image from Taylor et al., 2016
tail bud immature, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. 4 with image from Taylor et al., 2016
epithelial to mesenchymal transition delayed, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. S2 with image from Taylor et al., 2016
pericardium edematous, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. 4 with image,  Fig. S2 with image from Taylor et al., 2016
hatching delayed, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. S2 with image from Taylor et al., 2016
post-vent region curved, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. 4 with image,  Fig. S2 with image from Taylor et al., 2016
post-vent region bent, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. 4 with image from Taylor et al., 2016
epiboly involved in gastrulation with mouth forming second delayed, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. 4 with image,  Fig. S2 with image from Taylor et al., 2016
whole organism dorsal-ventral axis shortened, abnormal WT + MO1-slc39a10 + MO4-tp53 standard conditions Fig. 4 with image,  Fig. S2 with image from Taylor et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.