Morpholino

MO1-kif3a

ID
ZDB-MRPHLNO-160818-1
Name
MO1-kif3a
Previous Names
None
Target
Sequence
5' - GTCCAGCTTATTGCTCGGCATTATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-kif3a
Phenotype
Phenotype resulting from MO1-kif3a
Phenotype Fish Figures
blood vessel cilium decreased amount, abnormal hsc5Tg; pku6Tg + MO1-kif3a Fig. 2 with image from Liu et al., 2019
blood vessel cilium decreased length, abnormal hsc5Tg; pku6Tg + MO1-kif3a Fig. 2 with image from Liu et al., 2019
hematopoietic progenitor cell differentiation decreased occurrence, abnormal AB + MO1-kif3a Fig. 3 with imageFig. 5 with image from Liu et al., 2019
lateral crista cilium decreased amount, abnormal kif3asa1617/sa1617 + MO1-kif3a Fig. 1 from Pooranachandran et al., 2016
lateral crista cilium decreased length, abnormal kif3asa1617/sa1617 + MO1-kif3a Fig. 1 from Pooranachandran et al., 2016
ventral wall of dorsal aorta myb expression decreased amount, abnormal AB + MO1-kif3a Fig. 3 with image from Liu et al., 2019
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal AB + MO1-kif3a Fig. 3 with imageFig. 5 with image from Liu et al., 2019
ventral wall of dorsal aorta runx1 expression decreased distribution, abnormal AB + MO1-kif3a Fig. 3 with imageFig. 5 with image from Liu et al., 2019
ventral wall of dorsal aorta myb expression decreased distribution, abnormal AB + MO1-kif3a Fig. 3 with image from Liu et al., 2019
ventral wall of dorsal aorta endothelial cell mCherry expression decreased amount, abnormal jh11Tg; y1Tg + MO1-kif3a Fig. 6 with image from Liu et al., 2019
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell decreased amount, abnormal AB + MO1-kif3a Fig. 5 with image from Liu et al., 2019
whole organism curved, abnormal kif3asa1617/sa1617 + MO1-kif3a Fig. 1 from Pooranachandran et al., 2016
Phenotype of all Fish created by or utilizing MO1-kif3a
Phenotype Fish Conditions Figures
whole organism curved, abnormal kif3asa1617/sa1617 + MO1-kif3a standard conditions Fig. 1 from Pooranachandran et al., 2016
lateral crista cilium decreased amount, abnormal kif3asa1617/sa1617 + MO1-kif3a standard conditions Fig. 1 from Pooranachandran et al., 2016
lateral crista cilium decreased length, abnormal kif3asa1617/sa1617 + MO1-kif3a standard conditions Fig. 1 from Pooranachandran et al., 2016
ventral wall of dorsal aorta runx1 expression decreased distribution, abnormal AB + MO1-kif3a control Fig. 3 with imageFig. 5 with image from Liu et al., 2019
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell decreased amount, abnormal AB + MO1-kif3a control Fig. 5 with image from Liu et al., 2019
hematopoietic progenitor cell differentiation decreased occurrence, abnormal AB + MO1-kif3a control Fig. 3 with imageFig. 5 with image from Liu et al., 2019
ventral wall of dorsal aorta myb expression decreased distribution, abnormal AB + MO1-kif3a control Fig. 3 with image from Liu et al., 2019
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal AB + MO1-kif3a control Fig. 3 with imageFig. 5 with image from Liu et al., 2019
ventral wall of dorsal aorta myb expression decreased amount, abnormal AB + MO1-kif3a control Fig. 3 with image from Liu et al., 2019
lateral crista cilium decreased amount, abnormal WT + MO1-kif3a standard conditions Fig. 1 from Pooranachandran et al., 2016
lateral crista cilium decreased length, abnormal WT + MO1-kif3a standard conditions Fig. 1 from Pooranachandran et al., 2016
blood vessel cilium decreased length, abnormal hsc5Tg; pku6Tg + MO1-kif3a control Fig. 2 with image from Liu et al., 2019
blood vessel cilium decreased amount, abnormal hsc5Tg; pku6Tg + MO1-kif3a control Fig. 2 with image from Liu et al., 2019
ventral wall of dorsal aorta endothelial cell mCherry expression decreased amount, abnormal jh11Tg; y1Tg + MO1-kif3a control Fig. 6 with image from Liu et al., 2019
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell decreased amount, abnormal pku6Tg; zf169Tg + MO1-kif3a control Fig. 5 with image from Liu et al., 2019
Citations