Morpholino

MO1-alms1

ID
ZDB-MRPHLNO-160310-5
Name
MO1-alms1
Previous Names
  • e4i4 (1)
Target
Sequence
5' - TTAAGTGCTGAACTTACCGGGATTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-alms1
Expressed Gene Anatomy Figures
c3a.2 Fig. 7 from Hostelley et al., 2016
cela1.6 Fig. 7,  Fig. S3 from Hostelley et al., 2016
ctrb.1 Fig. S3 from Hostelley et al., 2016
ctrl Fig. S3 from Hostelley et al., 2016
gcga Fig. 2 from Lodh et al., 2016
gvin1l Fig. 7 from Hostelley et al., 2016
isl1a Fig. 2 from Lodh et al., 2016
neurod1 Fig. 2 from Lodh et al., 2016
pdx1 Fig. 2 from Lodh et al., 2016
prss1 Fig. S3 from Hostelley et al., 2016
prss59.1 Fig. 7,  Fig. S3 from Hostelley et al., 2016
smc1b Fig. 7 from Hostelley et al., 2016
snord31.1 Fig. 7 from Hostelley et al., 2016
snord31.2 Fig. 7 from Hostelley et al., 2016
sst1.1 Fig. 2 from Lodh et al., 2016
vtg7 Fig. 7 from Hostelley et al., 2016
Phenotype
Phenotype resulting from MO1-alms1
Phenotype Fish Figures
pancreatic B cell decreased amount, abnormal jh2Tg + MO1-alms1 Fig. 1. with image from Hostelley et al., 2021
Fig. 1 from Lodh et al., 2016
pancreatic B cell mCherry expression decreased amount, abnormal jh2Tg + MO1-alms1 Fig. 1 from Lodh et al., 2016
pancreatic B cell decreased area, abnormal jh2Tg + MO1-alms1 Fig. 1 from Lodh et al., 2016
pancreatic B cell decreased mass, abnormal jh2Tg + MO1-alms1 Fig. 1 from Lodh et al., 2016
whole organism vtg7 expression decreased amount, abnormal TU + MO1-alms1 Fig. 7 from Hostelley et al., 2016
whole organism ctrb.1 expression decreased amount, abnormal TU + MO1-alms1 Fig. S3 from Hostelley et al., 2016
whole organism gvin1l expression decreased amount, abnormal TU + MO1-alms1 Fig. 7 from Hostelley et al., 2016
whole organism cela1.6 expression decreased amount, abnormal TU + MO1-alms1 Fig. 7,  Fig. S3 from Hostelley et al., 2016
whole organism c3a.2 expression decreased amount, abnormal TU + MO1-alms1 Fig. 7 from Hostelley et al., 2016
whole organism snord31.1 expression decreased amount, abnormal TU + MO1-alms1 Fig. 7 from Hostelley et al., 2016
whole organism snord31.2 expression decreased amount, abnormal TU + MO1-alms1 Fig. 7 from Hostelley et al., 2016
whole organism ctrl expression decreased amount, abnormal TU + MO1-alms1 Fig. S3 from Hostelley et al., 2016
whole organism prss1 expression decreased amount, abnormal TU + MO1-alms1 Fig. S3 from Hostelley et al., 2016
whole organism prss59.1 expression decreased amount, abnormal TU + MO1-alms1 Fig. 7,  Fig. S3 from Hostelley et al., 2016
whole organism smc1b expression increased amount, abnormal TU + MO1-alms1 Fig. 7 from Hostelley et al., 2016
Phenotype of all Fish created by or utilizing MO1-alms1
Phenotype Fish Conditions Figures
whole organism c3a.2 expression decreased amount, abnormal TU + MO1-alms1 standard conditions Fig. 7 from Hostelley et al., 2016
whole organism ctrl expression decreased amount, abnormal TU + MO1-alms1 standard conditions Fig. S3 from Hostelley et al., 2016
whole organism gvin1l expression decreased amount, abnormal TU + MO1-alms1 standard conditions Fig. 7 from Hostelley et al., 2016
whole organism snord31.1 expression decreased amount, abnormal TU + MO1-alms1 standard conditions Fig. 7 from Hostelley et al., 2016
whole organism snord31.2 expression decreased amount, abnormal TU + MO1-alms1 standard conditions Fig. 7 from Hostelley et al., 2016
whole organism ctrb.1 expression decreased amount, abnormal TU + MO1-alms1 standard conditions Fig. S3 from Hostelley et al., 2016
whole organism prss59.1 expression decreased amount, abnormal TU + MO1-alms1 standard conditions Fig. 7,  Fig. S3 from Hostelley et al., 2016
whole organism vtg7 expression decreased amount, abnormal TU + MO1-alms1 standard conditions Fig. 7 from Hostelley et al., 2016
whole organism cela1.6 expression decreased amount, abnormal TU + MO1-alms1 standard conditions Fig. 7,  Fig. S3 from Hostelley et al., 2016
glucose homeostasis disrupted, abnormal TU + MO1-alms1 chemical treatment: D-glucopyranose Fig. 7 from Lodh et al., 2016
whole organism prss1 expression decreased amount, abnormal TU + MO1-alms1 standard conditions Fig. S3 from Hostelley et al., 2016
whole organism smc1b expression increased amount, abnormal TU + MO1-alms1 standard conditions Fig. 7 from Hostelley et al., 2016
pancreatic B cell decreased amount, abnormal WT + MO1-alms1 standard conditions Fig. 1. with image from Hostelley et al., 2021
pancreatic B cell mCherry expression decreased amount, abnormal jh2Tg + MO1-alms1 standard conditions Fig. 1 from Lodh et al., 2016
apoptotic process increased occurrence, abnormal jh2Tg + MO1-alms1 chemical treatment: D-glucopyranose Fig. 5 from Lodh et al., 2016
pancreatic B cell decreased mass, abnormal jh2Tg + MO1-alms1 standard conditions Fig. 1 from Lodh et al., 2016
pancreatic B cell decreased amount, abnormal jh2Tg + MO1-alms1 standard conditions Fig. 1 from Lodh et al., 2016
pancreatic B cell decreased area, abnormal jh2Tg + MO1-alms1 standard conditions Fig. 1 from Lodh et al., 2016
pancreatic B cell decreased amount, abnormal jh2Tg + MO1-alms1 chemical treatment: D-glucopyranose Fig. 3 from Lodh et al., 2016
pancreatic B cell apoptotic, abnormal jh2Tg + MO1-alms1 chemical treatment: D-glucopyranose Fig. 5 from Lodh et al., 2016
pancreas regeneration disrupted, abnormal jh4Tg + MO1-alms1 chemical treatment: metronidazole Fig. 6 from Lodh et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.