Morpholino

MO4-nr2f1b

ID
ZDB-MRPHLNO-160211-4
Name
MO4-nr2f1b
Previous Names
  • nr2f1b i1e2MO (1)
Target
Sequence
5' - AACCGCTATCAGAACACAGAGAGAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-nr2f1b
Phenotype
Phenotype resulting from MO4-nr2f1b
Phenotype Fish Figures
angioblast cell migration decreased process quality, abnormal la116Tg + MO4-nr2f1b Fig. 5 with image from Li et al., 2015
blood circulation disrupted, abnormal sd2Tg; y1Tg + MO4-nr2f1b Fig. S3 with image from Li et al., 2015
dorsal longitudinal anastomotic vessel structure, abnormal sd2Tg; y1Tg + MO4-nr2f1b Fig. S3 with image from Li et al., 2015
eye decreased size, abnormal TL + MO4-nr2f1b Fig. S3 with image from Li et al., 2015
intersegmental vessel decreased length, abnormal la116Tg + MO4-nr2f1b Fig. 2 with imageFig. 5 with image from Li et al., 2015
intersegmental vessel incomplete structure, abnormal la116Tg + MO4-nr2f1b Fig. 2 with image from Li et al., 2015
intersegmental vessel spatial pattern, abnormal la116Tg + MO4-nr2f1b Fig. 2 with image from Li et al., 2015
intersegmental vessel structure, abnormal sd2Tg; y1Tg + MO4-nr2f1b Fig. S3 with image from Li et al., 2015
intersegmental vessel cell decreased amount, abnormal ci5Tg; y7Tg + MO4-nr2f1b Fig. 2 with imageFig. 5 with imageFig. 6 with image from Li et al., 2015
parachordal vessel absent, abnormal sd2Tg; y1Tg + MO4-nr2f1b Fig. S3 with image from Li et al., 2015
pericardium edematous, abnormal TL + MO4-nr2f1b Fig. S3 with image from Li et al., 2015
posterior cardinal vein GFP expression decreased amount, abnormal la116Tg + MO4-nr2f1b Fig. 2 with image from Li et al., 2015
posterior cardinal vein endothelial cell decreased amount, abnormal y7Tg + MO4-nr2f1b Fig. 3 with image from Li et al., 2015
subintestinal vein structure, abnormal sd2Tg; y1Tg + MO4-nr2f1b Fig. S3 with image from Li et al., 2015
vasculature development disrupted, abnormal la116Tg + MO4-nr2f1b Fig. 2 with image from Li et al., 2015
vein flt4 expression decreased distribution, abnormal TL + MO4-nr2f1b Fig. 3 with image from Li et al., 2015
vein mrc1a expression decreased distribution, abnormal TL + MO4-nr2f1b Fig. 3 with image from Li et al., 2015
vein cell decreased amount, abnormal y7Tg + MO4-nr2f1b Fig. 3 with image from Li et al., 2015
whole organism flt4 expression decreased amount, abnormal TL + MO4-nr2f1b Fig. 3 with image from Li et al., 2015
Phenotype of all Fish created by or utilizing MO4-nr2f1b
Phenotype Fish Conditions Figures
vein flt4 expression decreased distribution, abnormal TL + MO4-nr2f1b control Fig. 3 with image from Li et al., 2015
pericardium edematous, abnormal TL + MO4-nr2f1b standard conditions Fig. S3 with image from Li et al., 2015
eye decreased size, abnormal TL + MO4-nr2f1b standard conditions Fig. S3 with image from Li et al., 2015
vein mrc1a expression decreased distribution, abnormal TL + MO4-nr2f1b control Fig. 3 with image from Li et al., 2015
whole organism flt4 expression decreased amount, abnormal TL + MO4-nr2f1b control Fig. 3 with image from Li et al., 2015
posterior cardinal vein GFP expression decreased amount, abnormal la116Tg + MO4-nr2f1b standard conditions Fig. 2 with image from Li et al., 2015
intersegmental vessel decreased length, abnormal la116Tg + MO4-nr2f1b standard conditions Fig. 2 with imageFig. 5 with image from Li et al., 2015
angioblast cell migration decreased process quality, abnormal la116Tg + MO4-nr2f1b standard conditions Fig. 5 with image from Li et al., 2015
vasculature development disrupted, abnormal la116Tg + MO4-nr2f1b standard conditions Fig. 2 with image from Li et al., 2015
intersegmental vessel incomplete structure, abnormal la116Tg + MO4-nr2f1b standard conditions Fig. 2 with image from Li et al., 2015
intersegmental vessel spatial pattern, abnormal la116Tg + MO4-nr2f1b standard conditions Fig. 2 with image from Li et al., 2015
posterior cardinal vein endothelial cell decreased amount, abnormal y7Tg + MO4-nr2f1b standard conditions Fig. 3 with image from Li et al., 2015
angioblast cell migration decreased process quality, abnormal y7Tg + MO4-nr2f1b standard conditions Fig. 5 with image from Li et al., 2015
intersegmental vessel cell decreased amount, abnormal y7Tg + MO4-nr2f1b standard conditions Fig. 5 with image from Li et al., 2015
vein cell decreased amount, abnormal y7Tg + MO4-nr2f1b standard conditions Fig. 3 with image from Li et al., 2015
intersegmental vessel cell decreased amount, abnormal ci5Tg; y7Tg + MO4-nr2f1b standard conditions Fig. 2 with imageFig. 6 with image from Li et al., 2015
parachordal vessel absent, abnormal sd2Tg; y1Tg + MO4-nr2f1b standard conditions Fig. S3 with image from Li et al., 2015
blood circulation disrupted, abnormal sd2Tg; y1Tg + MO4-nr2f1b standard conditions Fig. S3 with image from Li et al., 2015
dorsal longitudinal anastomotic vessel structure, abnormal sd2Tg; y1Tg + MO4-nr2f1b standard conditions Fig. S3 with image from Li et al., 2015
subintestinal vein structure, abnormal sd2Tg; y1Tg + MO4-nr2f1b standard conditions Fig. S3 with image from Li et al., 2015
intersegmental vessel structure, abnormal sd2Tg; y1Tg + MO4-nr2f1b standard conditions Fig. S3 with image from Li et al., 2015
intersegmental vessel cell amount, ameliorated ci5Tg; y7Tg + MO4-nr2f1b + MO4-rbpja,rbpjb standard conditions Fig. 6 with image from Li et al., 2015
Citations