Morpholino

MO1-cryaba

ID

ZDB-MRPHLNO-150828-3

Name

MO1-cryaba

Previous Names

None

Target

Sequence

5' - GCCCTGTATTTATGCCCCATCCCAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-cryaba

No data available

Phenotype

Phenotype resulting from MO1-cryaba

Phenotype	Fish	Figures
atrium decreased functionality, abnormal	WT + MO1-cryaba	Fig. 4 from Bührdel et al., 2015
cardiac ventricle decreased functionality, abnormal	WT + MO1-cryaba	Fig. 4 from Bührdel et al., 2015
heart contraction decreased rate, abnormal	WT + MO1-cryaba	Fig. 4 from Bührdel et al., 2015
locomotion disrupted, abnormal	WT + MO1-cryaba	Fig. 2 from Bührdel et al., 2015
muscle cell vacuole increased amount, abnormal	WT + MO1-cryaba	Fig. 3 from Bührdel et al., 2015
pericardium edematous, abnormal	WT + MO1-cryaba	Fig. 4 , Fig. S4 from Bührdel et al., 2015
skeletal muscle refractivity, abnormal	WT + MO1-cryaba	Fig. S4 from Bührdel et al., 2015
skeletal muscle nucleus circular, abnormal	WT + MO1-cryaba	Fig. 3 from Bührdel et al., 2015
skeletal muscle sarcomere disorganized, abnormal	WT + MO1-cryaba	Fig. 3 from Bührdel et al., 2015
thigmotaxis disrupted, abnormal	WT + MO1-cryaba	Fig. 2 from Bührdel et al., 2015
trunk curved, abnormal	WT + MO1-cryaba	Fig. S4 from Bührdel et al., 2015
whole organism decreased mobility, abnormal	WT + MO1-cryaba	Fig. 2 from Bührdel et al., 2015

Phenotype of all Fish created by or utilizing MO1-cryaba

Phenotype	Fish	Conditions	Figures
locomotion disrupted, abnormal	WT + MO1-cryaba	standard conditions	Fig. 2 from Bührdel et al., 2015
skeletal muscle refractivity, abnormal	WT + MO1-cryaba	standard conditions	Fig. S4 from Bührdel et al., 2015
skeletal muscle nucleus circular, abnormal	WT + MO1-cryaba	standard conditions	Fig. 3 from Bührdel et al., 2015
atrium decreased functionality, abnormal	WT + MO1-cryaba	standard conditions	Fig. 4 from Bührdel et al., 2015
thigmotaxis disrupted, abnormal	WT + MO1-cryaba	standard conditions	Fig. 2 from Bührdel et al., 2015
whole organism decreased mobility, abnormal	WT + MO1-cryaba	standard conditions	Fig. 2 from Bührdel et al., 2015
trunk curved, abnormal	WT + MO1-cryaba	standard conditions	Fig. S4 from Bührdel et al., 2015
heart contraction decreased rate, abnormal	WT + MO1-cryaba	standard conditions	Fig. 4 from Bührdel et al., 2015
cardiac ventricle decreased functionality, abnormal	WT + MO1-cryaba	standard conditions	Fig. 4 from Bührdel et al., 2015
skeletal muscle sarcomere disorganized, abnormal	WT + MO1-cryaba	standard conditions	Fig. 3 from Bührdel et al., 2015
pericardium edematous, abnormal	WT + MO1-cryaba	standard conditions	Fig. 4 , Fig. S4 from Bührdel et al., 2015
muscle cell vacuole increased amount, abnormal	WT + MO1-cryaba	standard conditions	Fig. 3 from Bührdel et al., 2015

Citations