Morpholino

MO3-mdm2

ID

ZDB-MRPHLNO-141210-18

Name

MO3-mdm2

Previous Names

None

Target

mdm2 (1)

Sequence

5' - AACAACTCTCTGTTGCCATTTTGGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-mdm2

No data available

Phenotype

Phenotype resulting from MO3-mdm2

Phenotype	Fish	Figures
pronephric tubule dilated, abnormal	li1Tg + MO3-mdm2	Fig. 2 from Thomasova et al., 2016
pronephric tubule morphology, ameliorated	li1Tg + MO3-mdm2 + MO4-tp53	Fig. 2 from Thomasova et al., 2016
pronephric tubule epithelial cell ab1-atp1a1 labeling amount, ameliorated	li1Tg + MO3-mdm2 + MO4-tp53	Fig. 2 from Thomasova et al., 2016
pronephric tubule epithelial cell apoptotic, abnormal	li1Tg + MO3-mdm2	Fig. 2 from Thomasova et al., 2016
pronephric tubule epithelial cell ab1-atp1a1 labeling decreased amount, abnormal	li1Tg + MO3-mdm2	Fig. 2 from Thomasova et al., 2016
pronephric tubule epithelial cell decreased amount, abnormal	li1Tg + MO3-mdm2	Fig. 2 from Thomasova et al., 2016
renal capsular space dilated, abnormal	li1Tg + MO3-mdm2	Fig. SMovie1 from Thomasova et al., 2016
renal capsular space morphology, ameliorated	li1Tg + MO3-mdm2 + MO4-tp53	Fig. SMovie2 from Thomasova et al., 2016

Phenotype of all Fish created by or utilizing MO3-mdm2

Phenotype	Fish	Conditions	Figures
pronephric tubule epithelial cell decreased amount, abnormal	li1Tg + MO3-mdm2	standard conditions	Fig. 2 from Thomasova et al., 2016
pronephric tubule epithelial cell apoptotic, abnormal	li1Tg + MO3-mdm2	standard conditions	Fig. 2 from Thomasova et al., 2016
renal capsular space dilated, abnormal	li1Tg + MO3-mdm2	standard conditions	Fig. SMovie1 from Thomasova et al., 2016
pronephric tubule dilated, abnormal	li1Tg + MO3-mdm2	standard conditions	Fig. 2 from Thomasova et al., 2016
pronephric tubule epithelial cell ab1-atp1a1 labeling decreased amount, abnormal	li1Tg + MO3-mdm2	standard conditions	Fig. 2 from Thomasova et al., 2016
renal capsular space morphology, ameliorated	li1Tg + MO3-mdm2 + MO4-tp53	standard conditions	Fig. SMovie2 from Thomasova et al., 2016
pronephric tubule epithelial cell ab1-atp1a1 labeling amount, ameliorated	li1Tg + MO3-mdm2 + MO4-tp53	standard conditions	Fig. 2 from Thomasova et al., 2016
pronephric tubule morphology, ameliorated	li1Tg + MO3-mdm2 + MO4-tp53	standard conditions	Fig. 2 from Thomasova et al., 2016
podocyte ab1-nphs1 labeling decreased amount, abnormal	mitfa^w2/w2; mpv17^a9/a9; li1Tg + MO1-mdm2 + MO3-mdm2	standard conditions	Fig. 2 from Thomasova et al., 2015
podocyte ab1-nphs1 labeling decreased distribution, abnormal	mitfa^w2/w2; mpv17^a9/a9; li1Tg + MO1-mdm2 + MO3-mdm2	standard conditions	Fig. 2 from Thomasova et al., 2015
pericardium edematous, abnormal	mitfa^w2/w2; mpv17^a9/a9; li1Tg + MO1-mdm2 + MO3-mdm2	standard conditions	Fig. 2 from Thomasova et al., 2015
pronephric glomerulus pronephric glomerular capillary malformed, abnormal	mitfa^w2/w2; mpv17^a9/a9; li1Tg + MO1-mdm2 + MO3-mdm2	standard conditions	Fig. 2 from Thomasova et al., 2015
pericardium edematous, abnormal	mitfa^w2/w2; mpv17^a9/a9; lri500Tg + MO3-mdm2	standard conditions	Fig. 2 from Thomasova et al., 2016
glomerular filtration disrupted, abnormal	mitfa^w2/w2; mpv17^a9/a9; lri500Tg + MO3-mdm2	standard conditions	Fig. 2 from Thomasova et al., 2016
pericardium morphology, ameliorated	mitfa^w2/w2; mpv17^a9/a9; lri500Tg + MO3-mdm2 + MO4-tp53	standard conditions	Fig. 2 from Thomasova et al., 2016
glomerular filtration process quality, ameliorated	mitfa^w2/w2; mpv17^a9/a9; lri500Tg + MO3-mdm2 + MO4-tp53	standard conditions	Fig. 2 from Thomasova et al., 2016

Citations