Morpholino

MO2-adarb1a

ID
ZDB-MRPHLNO-140924-6
Name
MO2-adarb1a
Previous Names
None
Target
Sequence
5' - CAAGACAACAAAACACTCACTCAAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-adarb1a
Expressed Gene Anatomy Figures
crestin Fig. 8 with image from Li et al., 2014
egr2b Fig. 5 with image from Li et al., 2014
fgf8a Fig. 5 with image from Li et al., 2014
pax6a Fig. 5 with image from Li et al., 2014
sox9a Fig. 5 with image from Li et al., 2014
sox9b Fig. 8 with image from Li et al., 2014
Phenotype
Phenotype resulting from MO2-adarb1a
Phenotype Fish Figures
apoptotic process increased process quality, abnormal WT + MO2-adarb1a Fig. 4 with image from Li et al., 2014
cranial cartilage malformed, abnormal WT + MO2-adarb1a Fig. 7 with image from Li et al., 2014
ethmoid cartilage absent, abnormal WT + MO2-adarb1a Fig. 7 with image from Li et al., 2014
eye apoptotic process increased process quality, abnormal WT + MO2-adarb1a Fig. 4 with image from Li et al., 2014
fourth ventricle increased size, abnormal WT + MO2-adarb1a Fig. 3 with image from Li et al., 2014
head decreased size, abnormal WT + MO2-adarb1a Fig. 3 with image from Li et al., 2014
head apoptotic process increased process quality, abnormal WT + MO2-adarb1a Fig. 4 with image from Li et al., 2014
hindbrain apoptotic process increased process quality, abnormal WT + MO2-adarb1a Fig. 4 with image from Li et al., 2014
horizontal myoseptum apoptotic process increased process quality, abnormal WT + MO2-adarb1a Fig. 4 with image from Li et al., 2014
midbrain apoptotic process increased process quality, abnormal WT + MO2-adarb1a Fig. 4 with image from Li et al., 2014
neural crest cell migration process quality, abnormal WT + MO2-adarb1a Fig. 8 with image from Li et al., 2014
neurocranial trabecula decreased size, abnormal WT + MO2-adarb1a Fig. 7 with image from Li et al., 2014
parachordal cartilage decreased size, abnormal WT + MO2-adarb1a Fig. 7 with image from Li et al., 2014
pharyngeal arch decreased size, abnormal WT + MO2-adarb1a Fig. 7 with image from Li et al., 2014
third ventricle increased size, abnormal WT + MO2-adarb1a Fig. 3 with image from Li et al., 2014
trunk apoptotic process increased process quality, abnormal WT + MO2-adarb1a Fig. 4 with image from Li et al., 2014
Phenotype of all Fish created by or utilizing MO2-adarb1a
Phenotype Fish Conditions Figures
cranial cartilage malformed, abnormal WT + MO2-adarb1a standard conditions Fig. 7 with image from Li et al., 2014
ethmoid cartilage absent, abnormal WT + MO2-adarb1a standard conditions Fig. 7 with image from Li et al., 2014
trunk apoptotic process increased process quality, abnormal WT + MO2-adarb1a standard conditions Fig. 4 with image from Li et al., 2014
head decreased size, abnormal WT + MO2-adarb1a standard conditions Fig. 3 with image from Li et al., 2014
neurocranial trabecula decreased size, abnormal WT + MO2-adarb1a standard conditions Fig. 7 with image from Li et al., 2014
hindbrain apoptotic process increased process quality, abnormal WT + MO2-adarb1a standard conditions Fig. 4 with image from Li et al., 2014
parachordal cartilage decreased size, abnormal WT + MO2-adarb1a standard conditions Fig. 7 with image from Li et al., 2014
neural crest cell migration process quality, abnormal WT + MO2-adarb1a standard conditions Fig. 8 with image from Li et al., 2014
midbrain apoptotic process increased process quality, abnormal WT + MO2-adarb1a standard conditions Fig. 4 with image from Li et al., 2014
third ventricle increased size, abnormal WT + MO2-adarb1a standard conditions Fig. 3 with image from Li et al., 2014
pharyngeal arch decreased size, abnormal WT + MO2-adarb1a standard conditions Fig. 7 with image from Li et al., 2014
head apoptotic process increased process quality, abnormal WT + MO2-adarb1a standard conditions Fig. 4 with image from Li et al., 2014
horizontal myoseptum apoptotic process increased process quality, abnormal WT + MO2-adarb1a standard conditions Fig. 4 with image from Li et al., 2014
apoptotic process increased process quality, abnormal WT + MO2-adarb1a standard conditions Fig. 4 with image from Li et al., 2014
fourth ventricle increased size, abnormal WT + MO2-adarb1a standard conditions Fig. 3 with image from Li et al., 2014
eye apoptotic process increased process quality, abnormal WT + MO2-adarb1a standard conditions Fig. 4 with image from Li et al., 2014
head decreased size, abnormal tp53zdf1/zdf1 + MO2-adarb1a standard conditions Fig. 3 with image from Li et al., 2014
neural crest cell migration process quality, abnormal tp53zdf1/zdf1 + MO2-adarb1a standard conditions Fig. 8 with image from Li et al., 2014
fourth ventricle increased size, abnormal tp53zdf1/zdf1 + MO2-adarb1a standard conditions Fig. 3 with image from Li et al., 2014
third ventricle increased size, abnormal tp53zdf1/zdf1 + MO2-adarb1a standard conditions Fig. 3 with image from Li et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.