Morpholino

MO2-ephb4a

ID
ZDB-MRPHLNO-140709-1
Name
MO2-ephb4a
Previous Names
  • AUG (1)
Target
Sequence
5' - GCGGAATCACGAGTGTTTTACTTGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ephb4a
No data available
Phenotype
Phenotype resulting from MO2-ephb4a
Phenotype Fish Figures
caudal vein plexus increased size, abnormal sd2Tg; y1Tg + MO2-ephb4a Fig. 2 from Kawasaki et al., 2014
caudal vein plexus malformed, abnormal sd2Tg; y1Tg + MO2-ephb4a Fig. 2 from Kawasaki et al., 2014
caudal vein plexus morphology, abnormal y1Tg + MO2-ephb4a Fig. S1 from Li et al., 2018
intersegmental artery decreased amount, abnormal y1Tg + MO2-ephb4a Fig. 3 from Kawasaki et al., 2014
intersegmental vein increased amount, abnormal y1Tg + MO2-ephb4a Fig. 3 from Kawasaki et al., 2014
intersegmental vessel branchiness, abnormal y1Tg + MO2-ephb4a Fig. S1 from Li et al., 2018
intersegmental vessel increased branchiness, abnormal y1Tg + MO2-ephb4a Fig. S1 from Li et al., 2018
post-vent region blood circulation absent, abnormal sd2Tg; y1Tg + MO2-ephb4a Fig. 2 from Kawasaki et al., 2014
post-vent vasculature fused with post-vent vasculature, abnormal y1Tg + MO2-ephb4a Fig. S1 from Li et al., 2018
post-vent vasculature increased amount, abnormal y1Tg + MO2-ephb4a Fig. S1 from Li et al., 2018
post-vent vasculature malformed, abnormal sd2Tg; y1Tg + MO2-ephb4a Fig. 2 from Kawasaki et al., 2014
Phenotype of all Fish created by or utilizing MO2-ephb4a
Phenotype Fish Conditions Figures
caudal vein plexus morphology, abnormal y1Tg + MO2-ephb4a standard conditions Fig. S1 from Li et al., 2018
post-vent vasculature increased amount, abnormal y1Tg + MO2-ephb4a standard conditions Fig. S1 from Li et al., 2018
intersegmental vein increased amount, abnormal y1Tg + MO2-ephb4a standard conditions Fig. 3 from Kawasaki et al., 2014
intersegmental artery decreased amount, abnormal y1Tg + MO2-ephb4a standard conditions Fig. 3 from Kawasaki et al., 2014
intersegmental vessel increased branchiness, abnormal y1Tg + MO2-ephb4a standard conditions Fig. S1 from Li et al., 2018
intersegmental vessel branchiness, abnormal y1Tg + MO2-ephb4a standard conditions Fig. S1 from Li et al., 2018
post-vent vasculature fused with post-vent vasculature, abnormal y1Tg + MO2-ephb4a standard conditions Fig. S1 from Li et al., 2018
caudal vein plexus increased size, abnormal sd2Tg; y1Tg + MO2-ephb4a standard conditions Fig. 2 from Kawasaki et al., 2014
post-vent region blood circulation absent, abnormal sd2Tg; y1Tg + MO2-ephb4a standard conditions Fig. 2 from Kawasaki et al., 2014
caudal vein plexus malformed, abnormal sd2Tg; y1Tg + MO2-ephb4a standard conditions Fig. 2 from Kawasaki et al., 2014
post-vent vasculature malformed, abnormal sd2Tg; y1Tg + MO2-ephb4a standard conditions Fig. 2 from Kawasaki et al., 2014
caudal vein plexus malformed, abnormal y1Tg + MO1-rasa1a + MO2-ephb4a standard conditions Fig. 3 from Kawasaki et al., 2014
post-vent vasculature malformed, abnormal y1Tg + MO1-rasa1a + MO2-ephb4a standard conditions Fig. 3 from Kawasaki et al., 2014
caudal vein plexus increased size, abnormal y1Tg + MO1-rasa1a + MO2-ephb4a standard conditions Fig. 3 from Kawasaki et al., 2014
caudal vein plexus malformed, abnormal y1Tg + MO2-efnb2a + MO2-ephb4a standard conditions Fig. 3 from Kawasaki et al., 2014
post-vent vasculature malformed, abnormal y1Tg + MO2-efnb2a + MO2-ephb4a standard conditions Fig. 3 from Kawasaki et al., 2014
caudal vein plexus increased size, abnormal y1Tg + MO2-efnb2a + MO2-ephb4a standard conditions Fig. 3 from Kawasaki et al., 2014
post-vent region blood circulation absent, abnormal sd2Tg; y1Tg + MO2-efnb2a + MO2-ephb4a standard conditions Fig. S6 from Kawasaki et al., 2014
caudal vein plexus malformed, abnormal y1Tg; zf520Tg + MO2-ephb4a standard conditions Fig. 5 from Kawasaki et al., 2014
caudal vein plexus increased size, abnormal y1Tg; zf520Tg + MO2-ephb4a standard conditions Fig. 5 from Kawasaki et al., 2014
post-vent vasculature malformed, abnormal y1Tg; zf520Tg + MO2-ephb4a standard conditions Fig. 5 from Kawasaki et al., 2014
post-vent region blood circulation absent, abnormal y1Tg; zf520Tg + MO2-ephb4a standard conditions Fig. 5 from Kawasaki et al., 2014
caudal vein plexus malformed, abnormal y1Tg; zf520Tg + MO2-efnb2a + MO2-ephb4a standard conditions Fig. 5 from Kawasaki et al., 2014
post-vent vasculature malformed, abnormal y1Tg; zf520Tg + MO2-efnb2a + MO2-ephb4a standard conditions Fig. 5 from Kawasaki et al., 2014
caudal vein plexus increased size, abnormal y1Tg; zf520Tg + MO2-efnb2a + MO2-ephb4a standard conditions Fig. 5 from Kawasaki et al., 2014
post-vent region blood circulation absent, abnormal y1Tg; zf520Tg + MO2-efnb2a + MO2-ephb4a standard conditions Fig. 5 from Kawasaki et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.