Morpholino

MO2-lingo1b

ID

ZDB-MRPHLNO-140606-5

Name

MO2-lingo1b

Previous Names

Target

Sequence

5' - ACGTCATGCGGTGGAGTCTAAATTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-lingo1b

No data available

Phenotype

Phenotype resulting from MO2-lingo1b

Phenotype	Fish	Figures
eye decreased size, abnormal	WT + MO2-lingo1b	Fig. 4 from Yin et al., 2014
larval locomotory behavior decreased process quality, abnormal	WT + MO2-lingo1b	Fig. 7 from Yin et al., 2014
Mauthner neuron decreased diameter, abnormal	WT + MO2-lingo1b	Fig. 5, Fig. 6 from Yin et al., 2014
Mauthner neuron myelin sheath increased thickness, abnormal	WT + MO2-lingo1b	Fig. 5 from Yin et al., 2014
Mauthner neuron myelination increased process quality, abnormal	WT + MO2-lingo1b	Fig. 5 from Yin et al., 2014
myelination premature, abnormal	WT + MO2-lingo1b	Fig. 5 from Yin et al., 2014
neuron myelin sheath increased thickness, abnormal	WT + MO2-lingo1b	Fig. 5 from Yin et al., 2014
neuron myelination increased process quality, abnormal	WT + MO2-lingo1b	Fig. 5 from Yin et al., 2014
oligodendrocyte cell migration decreased process quality, abnormal	vu12Tg/+ + MO2-lingo1b (AB)	Fig. 5 from Yin et al., 2014
optokinetic behavior decreased process quality, abnormal	WT + MO2-lingo1b	Fig. 7 from Yin et al., 2014
spinal cord curved, abnormal	WT + MO2-lingo1b	Fig. 4 from Yin et al., 2014

Phenotype of all Fish created by or utilizing MO2-lingo1b

Phenotype	Fish	Conditions	Figures
neuron myelin sheath increased thickness, abnormal	WT + MO2-lingo1b	standard conditions	Fig. 5 from Yin et al., 2014
Mauthner neuron decreased diameter, abnormal	WT + MO2-lingo1b	standard conditions	Fig. 5, Fig. 6 from Yin et al., 2014
optokinetic behavior decreased process quality, abnormal	WT + MO2-lingo1b	standard conditions	Fig. 7 from Yin et al., 2014
eye decreased size, abnormal	WT + MO2-lingo1b	standard conditions	Fig. 4 from Yin et al., 2014
larval locomotory behavior decreased process quality, abnormal	WT + MO2-lingo1b	standard conditions	Fig. 7 from Yin et al., 2014
spinal cord curved, abnormal	WT + MO2-lingo1b	standard conditions	Fig. 4 from Yin et al., 2014
Mauthner neuron myelination increased process quality, abnormal	WT + MO2-lingo1b	standard conditions	Fig. 5 from Yin et al., 2014
Mauthner neuron myelin sheath increased thickness, abnormal	WT + MO2-lingo1b	standard conditions	Fig. 5 from Yin et al., 2014
myelination premature, abnormal	WT + MO2-lingo1b	standard conditions	Fig. 5 from Yin et al., 2014
neuron myelination increased process quality, abnormal	WT + MO2-lingo1b	standard conditions	Fig. 5 from Yin et al., 2014
oligodendrocyte cell migration decreased process quality, abnormal	vu12Tg/+ + MO2-lingo1b (AB)	standard conditions	Fig. 5 from Yin et al., 2014

Citations