Morpholino

MO2-las1l

ID
ZDB-MRPHLNO-140523-2
Name
MO2-las1l
Previous Names
  • exon 10 (1)
Target
Sequence
5' - CTGCCACACAATGACAGAGAGGGCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-las1l
No data available
Phenotype
Phenotype resulting from MO2-las1l
Phenotype Fish Figures
brain malformed, abnormal WT + MO2-las1l Fig. 1 from Butterfield et al., 2014
brain shortened, abnormal WT + MO2-las1l Fig. 1 from Butterfield et al., 2014
caudal fin necrotic, abnormal WT + MO2-las1l Fig. 1 from Butterfield et al., 2014
fast muscle cell disorganized, abnormal WT + MO2-las1l Fig. 2 from Butterfield et al., 2014
fast muscle cell disoriented, abnormal WT + MO2-las1l Fig. 2 from Butterfield et al., 2014
fast muscle cell shortened, abnormal WT + MO2-las1l Fig. 2 from Butterfield et al., 2014
horizontal myoseptum morphology, abnormal WT + MO2-las1l Fig. 2 from Butterfield et al., 2014
muscle morphology, abnormal WT + MO2-las1l Fig. 2 from Butterfield et al., 2014
primary motor neuron morphology, abnormal WT + MO2-las1l Fig. 2 from Butterfield et al., 2014
slow muscle cell disorganized, abnormal WT + MO2-las1l Fig. 2 from Butterfield et al., 2014
slow muscle cell shortened, abnormal WT + MO2-las1l Fig. 2 from Butterfield et al., 2014
whole organism decreased life span, abnormal WT + MO2-las1l Fig. 1 from Butterfield et al., 2014
whole organism apoptotic process increased process quality, abnormal WT + MO2-las1l Fig. 2 from Butterfield et al., 2014
Phenotype of all Fish created by or utilizing MO2-las1l
Phenotype Fish Conditions Figures
horizontal myoseptum morphology, abnormal WT + MO2-las1l standard conditions Fig. 2 from Butterfield et al., 2014
whole organism apoptotic process increased process quality, abnormal WT + MO2-las1l standard conditions Fig. 2 from Butterfield et al., 2014
fast muscle cell disorganized, abnormal WT + MO2-las1l standard conditions Fig. 2 from Butterfield et al., 2014
fast muscle cell shortened, abnormal WT + MO2-las1l standard conditions Fig. 2 from Butterfield et al., 2014
slow muscle cell shortened, abnormal WT + MO2-las1l standard conditions Fig. 2 from Butterfield et al., 2014
primary motor neuron morphology, abnormal WT + MO2-las1l standard conditions Fig. 2 from Butterfield et al., 2014
muscle morphology, abnormal WT + MO2-las1l standard conditions Fig. 2 from Butterfield et al., 2014
caudal fin necrotic, abnormal WT + MO2-las1l standard conditions Fig. 1 from Butterfield et al., 2014
whole organism decreased life span, abnormal WT + MO2-las1l standard conditions Fig. 1 from Butterfield et al., 2014
brain malformed, abnormal WT + MO2-las1l standard conditions Fig. 1 from Butterfield et al., 2014
brain shortened, abnormal WT + MO2-las1l standard conditions Fig. 1 from Butterfield et al., 2014
slow muscle cell disorganized, abnormal WT + MO2-las1l standard conditions Fig. 2 from Butterfield et al., 2014
fast muscle cell disoriented, abnormal WT + MO2-las1l standard conditions Fig. 2 from Butterfield et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.