Morpholino

MO2-hsbp1b

ID

ZDB-MRPHLNO-140430-3

Name

MO2-hsbp1b

Previous Names

None

Target

hsbp1b (1)

Sequence

5' - TGCACCTGTTTGGGACAAACTGTTA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-hsbp1b

Expressed Gene	Anatomy	Figures
foxd3	anatomical structure	Fig. 5 from Eroglu et al., 2014
snai1b	anatomical structure	Fig. 5 from Eroglu et al., 2014
tfap2a	non neural ectoderm	Fig. 5 from Eroglu et al., 2014

Phenotype

Phenotype resulting from MO2-hsbp1b

Phenotype	Fish	Figures
anatomical structure foxd3 expression increased amount, abnormal	WT + MO2-hsbp1b	Fig. 5 from Eroglu et al., 2014
anatomical structure snai1b expression increased amount, abnormal	WT + MO2-hsbp1b	Fig. 5 from Eroglu et al., 2014
central nervous system apoptotic, abnormal	WT + MO2-hsbp1b	text only from Eroglu et al., 2014
embryo development disrupted, abnormal	WT + MO2-hsbp1b + MO4-tp53	Fig. S7 from Eroglu et al., 2014
head deformed, abnormal	WT + MO2-hsbp1b	Fig. S7 , Table S3 from Eroglu et al., 2014
heart deformed, abnormal	WT + MO2-hsbp1b + MO4-tp53	Table S3 from Eroglu et al., 2014
neural crest formation process quality, abnormal	WT + MO2-hsbp1b	Fig. 5 from Eroglu et al., 2014
non neural ectoderm tfap2a expression increased amount, abnormal	WT + MO2-hsbp1b	Fig. 5 from Eroglu et al., 2014
whole organism decreased length, abnormal	WT + MO2-hsbp1b + MO4-tp53	Fig. S7 from Eroglu et al., 2014
whole organism anterior-posterior axis increased curvature, abnormal	WT + MO2-hsbp1b	Fig. S7 , Table S3 from Eroglu et al., 2014
yolk increased size, abnormal	WT + MO2-hsbp1b	Table S3 from Eroglu et al., 2014

Phenotype of all Fish created by or utilizing MO2-hsbp1b

Phenotype	Fish	Conditions	Figures
whole organism decreased length, abnormal	WT + MO2-hsbp1b	standard conditions	Fig. S7 from Eroglu et al., 2014
anatomical structure snai1b expression increased amount, abnormal	WT + MO2-hsbp1b	standard conditions	Fig. 5 from Eroglu et al., 2014
head deformed, abnormal	WT + MO2-hsbp1b	standard conditions	Fig. S7 , Table S3 from Eroglu et al., 2014
heart deformed, abnormal	WT + MO2-hsbp1b	standard conditions	Table S3 from Eroglu et al., 2014
central nervous system apoptotic, abnormal	WT + MO2-hsbp1b	standard conditions	text only from Eroglu et al., 2014
non neural ectoderm tfap2a expression increased amount, abnormal	WT + MO2-hsbp1b	standard conditions	Fig. 5 from Eroglu et al., 2014
yolk increased size, abnormal	WT + MO2-hsbp1b	standard conditions	Table S3 from Eroglu et al., 2014
whole organism anterior-posterior axis increased curvature, abnormal	WT + MO2-hsbp1b	standard conditions	Fig. S7 , Table S3 from Eroglu et al., 2014
anatomical structure foxd3 expression increased amount, abnormal	WT + MO2-hsbp1b	standard conditions	Fig. 5 from Eroglu et al., 2014
neural crest formation process quality, abnormal	WT + MO2-hsbp1b	standard conditions	Fig. 5 from Eroglu et al., 2014
embryo development disrupted, abnormal	WT + MO2-hsbp1b	standard conditions	Fig. S7 from Eroglu et al., 2014
embryo development disrupted, abnormal	WT + MO2-hsbp1b + MO4-tp53	standard conditions	Fig. S7 from Eroglu et al., 2014
head deformed, abnormal	WT + MO2-hsbp1b + MO4-tp53	standard conditions	Fig. S7 , Table S3 from Eroglu et al., 2014
heart deformed, abnormal	WT + MO2-hsbp1b + MO4-tp53	standard conditions	Table S3 from Eroglu et al., 2014
yolk increased size, abnormal	WT + MO2-hsbp1b + MO4-tp53	standard conditions	Table S3 from Eroglu et al., 2014
whole organism decreased length, abnormal	WT + MO2-hsbp1b + MO4-tp53	standard conditions	Fig. S7 from Eroglu et al., 2014
whole organism anterior-posterior axis increased curvature, abnormal	WT + MO2-hsbp1b + MO4-tp53	standard conditions	Fig. S7 , Table S3 from Eroglu et al., 2014

Citations