Morpholino

MO6-etv5a

ID
ZDB-MRPHLNO-140402-4
Name
MO6-etv5a
Previous Names
None
Target
Sequence
5' - GATCTTCGCTTAAAAGCGATAGCTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO6-etv5a
No data available
Phenotype
Phenotype resulting from MO6-etv5a
Phenotype Fish Figures
angiogenesis disrupted, abnormal y1Tg + MO6-etv5a Fig. S3 from Chen et al., 2013
blood vessel development disrupted, abnormal y1Tg + MO6-etv5a Fig. S3 from Chen et al., 2013
common lymphoid progenitor decreased amount, abnormal TU + MO6-etv5a Fig. S3 from Chen et al., 2013
erythroid lineage cell decreased amount, abnormal TU + MO6-etv5a Fig. S3 from Chen et al., 2013
granulocyte decreased amount, abnormal TU + MO6-etv5a Fig. S3 from Chen et al., 2013
hemangioblast cell differentiation disrupted, abnormal TU + MO6-etv5a Fig. S3 from Chen et al., 2013
hematopoietic stem cell decreased amount, abnormal TU + MO6-etv5a Fig. S3 from Chen et al., 2013
hematopoietic stem cell differentiation disrupted, abnormal TU + MO6-etv5a Fig. S3 from Chen et al., 2013
hemopoiesis disrupted, abnormal TU + MO6-etv5a Fig. S3 from Chen et al., 2013
intersegmental vessel morphology, abnormal y1Tg + MO6-etv5a Fig. S3 from Chen et al., 2013
subintestinal vein hypoplastic, abnormal y1Tg + MO6-etv5a Fig. S3 from Chen et al., 2013
ventral mesoderm cell population proliferation increased occurrence, abnormal TU + MO6-etv5a Fig. S3 from Chen et al., 2013
Phenotype of all Fish created by or utilizing MO6-etv5a
Phenotype Fish Conditions Figures
granulocyte decreased amount, abnormal TU + MO6-etv5a standard conditions Fig. S3 from Chen et al., 2013
common lymphoid progenitor decreased amount, abnormal TU + MO6-etv5a standard conditions Fig. S3 from Chen et al., 2013
hematopoietic stem cell decreased amount, abnormal TU + MO6-etv5a standard conditions Fig. S3 from Chen et al., 2013
ventral mesoderm cell population proliferation increased occurrence, abnormal TU + MO6-etv5a standard conditions Fig. S3 from Chen et al., 2013
hemangioblast cell differentiation disrupted, abnormal TU + MO6-etv5a standard conditions Fig. S3 from Chen et al., 2013
hematopoietic stem cell differentiation disrupted, abnormal TU + MO6-etv5a standard conditions Fig. S3 from Chen et al., 2013
hemopoiesis disrupted, abnormal TU + MO6-etv5a standard conditions Fig. S3 from Chen et al., 2013
erythroid lineage cell decreased amount, abnormal TU + MO6-etv5a standard conditions Fig. S3 from Chen et al., 2013
angiogenesis disrupted, abnormal y1Tg + MO6-etv5a standard conditions Fig. S3 from Chen et al., 2013
intersegmental vessel morphology, abnormal y1Tg + MO6-etv5a standard conditions Fig. S3 from Chen et al., 2013
subintestinal vein hypoplastic, abnormal y1Tg + MO6-etv5a standard conditions Fig. S3 from Chen et al., 2013
blood vessel development disrupted, abnormal y1Tg + MO6-etv5a standard conditions Fig. S3 from Chen et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.