Morpholino

MO4-sulf1

ID
ZDB-MRPHLNO-140321-2
Name
MO4-sulf1
Previous Names
  • S1-SB (1)
Target
Sequence
5' - GTAGTCCTGGTAGTGGTAGAATAAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-sulf1
Phenotype
Phenotype resulting from MO4-sulf1
Phenotype Fish Figures
axial vasculature blood circulation disrupted, abnormal WT + MO4-sulf1 Fig. 4 from Gorsi et al., 2014
caudal artery dissociated from caudal vein, abnormal zf3202Tg + MO4-sulf1 Fig. 1 with image from Schenk et al., 2019
caudal fin curved, abnormal lri500Tg + MO4-sulf1 Fig. 2 from Schenk et al., 2019
caudal fin blood circulation decreased occurrence, abnormal WT + MO4-sulf1 Fig. 1 with image from Schenk et al., 2019
cranial vasculature blood circulation disrupted, abnormal WT + MO4-sulf1 Fig. 4 from Gorsi et al., 2014
glomerular filtration process quality, abnormal lri500Tg + MO4-sulf1 Fig. 2 from Schenk et al., 2019
optic choroid vascular plexus EGFP expression decreased amount, abnormal lri500Tg + MO4-sulf1 Fig. 2 from Schenk et al., 2019
pericardium edematous, abnormal lri500Tg + MO4-sulf1 Fig. 2 from Schenk et al., 2019
post-vent vasculature morphology, abnormal WT + MO4-sulf1 Fig. 1 with image from Schenk et al., 2019
pronephric glomerular basement membrane structure, abnormal WT + MO4-sulf1 Fig. 3 from Schenk et al., 2019
pronephric glomerulus morphology, abnormal WT + MO4-sulf1 Fig. 3 from Schenk et al., 2019
pronephric podocyte morphology, abnormal WT + MO4-sulf1 Fig. 3 from Schenk et al., 2019
whole organism sulf2a expression increased amount, abnormal WT + MO4-sulf1 Fig. 2 from Schenk et al., 2019
whole organism sulf2b expression increased amount, abnormal WT + MO4-sulf1 Fig. 2 from Schenk et al., 2019
yolk edematous, abnormal lri500Tg + MO4-sulf1 Fig. 2 from Schenk et al., 2019
Phenotype of all Fish created by or utilizing MO4-sulf1
Phenotype Fish Conditions Figures
pronephric glomerular basement membrane structure, abnormal WT + MO4-sulf1 control Fig. 3 from Schenk et al., 2019
cranial vasculature blood circulation disrupted, abnormal WT + MO4-sulf1 standard conditions Fig. 4 from Gorsi et al., 2014
axial vasculature blood circulation disrupted, abnormal WT + MO4-sulf1 standard conditions Fig. 4 from Gorsi et al., 2014
pronephric glomerulus morphology, abnormal WT + MO4-sulf1 control Fig. 3 from Schenk et al., 2019
caudal fin blood circulation decreased occurrence, abnormal WT + MO4-sulf1 control Fig. 1 with image from Schenk et al., 2019
post-vent vasculature morphology, abnormal WT + MO4-sulf1 control Fig. 1 with image from Schenk et al., 2019
whole organism sulf2b expression increased amount, abnormal WT + MO4-sulf1 control Fig. 2 from Schenk et al., 2019
pronephric podocyte morphology, abnormal WT + MO4-sulf1 control Fig. 3 from Schenk et al., 2019
whole organism sulf2a expression increased amount, abnormal WT + MO4-sulf1 control Fig. 2 from Schenk et al., 2019
optic choroid vascular plexus EGFP expression decreased amount, abnormal lri500Tg + MO4-sulf1 physical alteration: pronephric glomerulus, chemical treatment by environment: 3'-amino-3'-deoxy-N(6),N(6)-dimethyladenosine Fig. 7 from Schenk et al., 2019
pericardium edematous, abnormal lri500Tg + MO4-sulf1 control Fig. 2 from Schenk et al., 2019
yolk edematous, abnormal lri500Tg + MO4-sulf1 control Fig. 2 from Schenk et al., 2019
caudal fin curved, abnormal lri500Tg + MO4-sulf1 control Fig. 2 from Schenk et al., 2019
glomerular filtration process quality, abnormal lri500Tg + MO4-sulf1 control Fig. 2 from Schenk et al., 2019
optic choroid vascular plexus EGFP expression decreased amount, abnormal lri500Tg + MO4-sulf1 control Fig. 2 from Schenk et al., 2019
glomerular filtration process quality, abnormal lri500Tg + MO4-sulf1 physical alteration: pronephric glomerulus, chemical treatment by environment: 3'-amino-3'-deoxy-N(6),N(6)-dimethyladenosine Fig. 7 from Schenk et al., 2019
caudal artery dissociated from caudal vein, abnormal zf3202Tg + MO4-sulf1 control Fig. 1 with image from Schenk et al., 2019
pronephric glomerular basement membrane structure, abnormal WT + MO1-sulf2b + MO2-sulf2a + MO4-sulf1 control Fig. 3 from Schenk et al., 2019
pronephric glomerulus morphology, abnormal WT + MO1-sulf2b + MO2-sulf2a + MO4-sulf1 control Fig. 3 from Schenk et al., 2019
pronephric podocyte morphology, abnormal WT + MO1-sulf2b + MO2-sulf2a + MO4-sulf1 control Fig. 3 from Schenk et al., 2019
Citations