Morpholino
MO8-nrp1a
- ID
- ZDB-MRPHLNO-130827-3
- Name
- MO8-nrp1a
- Previous Names
-
- targets the splice junction between exons 2 and 3 (1)
- Target
- Sequence
-
5' - AATGTTTTTTCCTTACCCGTTTTGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO8-nrp1a
No data available
Phenotype
Phenotype resulting from MO8-nrp1a
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO8-nrp1a
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
brain hemorrhagic, abnormal | WT + MO4-tp53 + MO8-nrp1a | control |
Fig. 4 ![]() |
brain vasculature development process quality, abnormal | WT + MO4-tp53 + MO8-nrp1a | control |
Fig. 4 ![]() |
brain vasculature broken, abnormal | WT + MO4-tp53 + MO8-nrp1a | control |
Fig. 4 ![]() |
brain vasculature development process quality, abnormal | WT + MO1-itgb8 + MO4-tp53 + MO8-nrp1a | control |
Fig. 4 ![]() |
brain hemorrhagic, abnormal | WT + MO1-itgb8 + MO4-tp53 + MO8-nrp1a | control |
Fig. 4 ![]() |
1 - 5 of 6 Show all
Citations
- Hirota, S., Clements, T.P., Tang, L.K., Morales, J.E., Lee, H.S., Oh, S.P., Rivera, G.M., Wagner, D.S., McCarty, J.H. (2015) Neuropilin 1 balances β8 integrin-activated TGFβ signaling to control sprouting angiogenesis in the brain. Development (Cambridge, England). 142:4363-73
- Dell, A.L., Fried-Cassorla, E., Xu, H., and Raper, J.A. (2013) cAMP-Induced Expression of Neuropilin1 Promotes Retinal Axon Crossing in the Zebrafish Optic Chiasm. The Journal of neuroscience : the official journal of the Society for Neuroscience. 33(27):11076-11088
1 - 2 of 2
Show