Morpholino

MO2-sulf1

ID
ZDB-MRPHLNO-130805-3
Name
MO2-sulf1
Previous Names
  • splice AMO (1)
Target
Sequence
5' - ATCCTGACACACAAGACAGACAACA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-sulf1
Expressed Gene Anatomy Figures
cxcl12a Fig. 8 with image from Meyers et al., 2013
fgf10a Fig. 9 with image from Meyers et al., 2013
ptch2 Fig. 4 with image from Meyers et al., 2013
Phenotype
Phenotype resulting from MO2-sulf1
Phenotype Fish Figures
caudal fin curved, abnormal WT + MO2-sulf1 Fig. 2 with image from Meyers et al., 2013
caudal fin increased width, abnormal WT + MO2-sulf1 Fig. 2 with image from Meyers et al., 2013
horizontal myoseptum absent, abnormal WT + MO2-sulf1 Fig. 2 with image,  Fig. 6 with image from Meyers et al., 2013
lateral larval melanophore stripe absent, abnormal WT + MO2-sulf1 Fig. 3 with image from Meyers et al., 2013
lateral larval melanophore stripe has fewer parts of type melanocyte, abnormal WT + MO2-sulf1 Fig. 7 with image from Meyers et al., 2013
lateral line morphology, abnormal zf106Tg + MO2-sulf1 Fig. 8 with image from Meyers et al., 2013
lateral line development process quality, abnormal zf106Tg + MO2-sulf1 Fig. 8 with image from Meyers et al., 2013
muscle cell sparse, abnormal WT + MO2-sulf1 Fig. 2 with image,  Fig. 6 with image from Meyers et al., 2013
muscle pioneer decreased amount, abnormal WT + MO2-sulf1 Fig. 3 with image from Meyers et al., 2013
neuromast decreased amount, abnormal zf106Tg + MO2-sulf1 Fig. 9 with image from Meyers et al., 2013
neuromast decreased size, abnormal WT + MO2-sulf1 Fig. 9 with image from Meyers et al., 2013
neuromast dispersed, abnormal zf106Tg + MO2-sulf1 Fig. 9 with image from Meyers et al., 2013
neuromast deposition decreased process quality, abnormal zf106Tg + MO2-sulf1 Fig. 9 with image from Meyers et al., 2013
neuromast primordium migration process quality, abnormal zf106Tg + MO2-sulf1 Fig. 9 with image from Meyers et al., 2013
somite decreased width, abnormal WT + MO2-sulf1 Fig. 2 with image,  Fig. 3 with image,  Fig. 7 with image from Meyers et al., 2013
somite has fewer parts of type fast muscle cell, abnormal WT + MO2-sulf1 Fig. 5 with image from Meyers et al., 2013
somite has fewer parts of type muscle pioneer, abnormal WT + MO2-sulf1 Fig. 5 with image from Meyers et al., 2013
somite obtuse angle to somite, abnormal WT + MO2-sulf1 Fig. 2 with image,  Fig. 3 with image,  Fig. 7 with image from Meyers et al., 2013
somite shape, abnormal WT + MO2-sulf1 Fig. 2 with image,  Fig. 4 with image from Meyers et al., 2013
somite tight, abnormal WT + MO2-sulf1 Fig. 2 with image from Meyers et al., 2013
Phenotype of all Fish created by or utilizing MO2-sulf1
Phenotype Fish Conditions Figures
lateral larval melanophore stripe absent, abnormal WT + MO2-sulf1 standard conditions Fig. 3 with image from Meyers et al., 2013
somite decreased width, abnormal WT + MO2-sulf1 standard conditions Fig. 2 with image,  Fig. 3 with image,  Fig. 7 with image from Meyers et al., 2013
caudal fin increased width, abnormal WT + MO2-sulf1 standard conditions Fig. 2 with image from Meyers et al., 2013
caudal fin curved, abnormal WT + MO2-sulf1 standard conditions Fig. 2 with image from Meyers et al., 2013
muscle pioneer decreased amount, abnormal WT + MO2-sulf1 standard conditions Fig. 3 with image from Meyers et al., 2013
neuromast decreased size, abnormal WT + MO2-sulf1 standard conditions Fig. 9 with image from Meyers et al., 2013
somite shape, abnormal WT + MO2-sulf1 standard conditions Fig. 2 with image,  Fig. 4 with image from Meyers et al., 2013
muscle cell sparse, abnormal WT + MO2-sulf1 standard conditions Fig. 2 with image,  Fig. 6 with image from Meyers et al., 2013
somite has fewer parts of type muscle pioneer, abnormal WT + MO2-sulf1 standard conditions Fig. 5 with image from Meyers et al., 2013
somite obtuse angle to somite, abnormal WT + MO2-sulf1 standard conditions Fig. 2 with image,  Fig. 3 with image,  Fig. 7 with image from Meyers et al., 2013
horizontal myoseptum absent, abnormal WT + MO2-sulf1 standard conditions Fig. 2 with image,  Fig. 6 with image from Meyers et al., 2013
lateral larval melanophore stripe has fewer parts of type melanocyte, abnormal WT + MO2-sulf1 standard conditions Fig. 7 with image from Meyers et al., 2013
somite has fewer parts of type fast muscle cell, abnormal WT + MO2-sulf1 standard conditions Fig. 5 with image from Meyers et al., 2013
somite tight, abnormal WT + MO2-sulf1 standard conditions Fig. 2 with image from Meyers et al., 2013
lateral line morphology, abnormal zf106Tg + MO2-sulf1 standard conditions Fig. 8 with image from Meyers et al., 2013
neuromast decreased amount, abnormal zf106Tg + MO2-sulf1 standard conditions Fig. 9 with image from Meyers et al., 2013
lateral line development process quality, abnormal zf106Tg + MO2-sulf1 standard conditions Fig. 8 with image from Meyers et al., 2013
neuromast dispersed, abnormal zf106Tg + MO2-sulf1 standard conditions Fig. 9 with image from Meyers et al., 2013
neuromast deposition decreased process quality, abnormal zf106Tg + MO2-sulf1 standard conditions Fig. 9 with image from Meyers et al., 2013
neuromast primordium migration process quality, abnormal zf106Tg + MO2-sulf1 standard conditions Fig. 9 with image from Meyers et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.