Morpholino

MO2-tshz2

ID

ZDB-MRPHLNO-130729-7

Name

MO2-tshz2

Previous Names

Target

Sequence

5' - GTATGCTGGAAACAGAACAGACAGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-tshz2

No data available

Phenotype

Phenotype resulting from MO2-tshz2

Phenotype	Fish	Figures
ceratobranchial cartilage absent, abnormal	WT + MO2-tshz2	Fig. 6 from Melvin et al., 2013
ceratohyal cartilage flattened, abnormal	WT + MO2-tshz2	Fig. 6 from Melvin et al., 2013
ceratohyal cartilage inverted, abnormal	WT + MO2-tshz2	Fig. 6 from Melvin et al., 2013
cranial cartilage absent, abnormal	WT + MO2-tshz2	Fig. 6 from Melvin et al., 2013
ethmoid cartilage absent, abnormal	WT + MO2-tshz2	Fig. 6 from Melvin et al., 2013
ethmoid cartilage decreased size, abnormal	WT + MO2-tshz2	Fig. 6 from Melvin et al., 2013
head anterior side collapsed, abnormal	WT + MO2-tshz2	Fig. 6 from Melvin et al., 2013
hyosymplectic cartilage malformed, abnormal	WT + MO2-tshz2	Fig. 6 from Melvin et al., 2013
Meckel's cartilage malformed, abnormal	WT + MO2-tshz2	Fig. 6 from Melvin et al., 2013
neurocranial trabecula fused with neurocranial trabecula, abnormal	WT + MO2-tshz2	Fig. 6 from Melvin et al., 2013
palatoquadrate cartilage malformed, abnormal	WT + MO2-tshz2	Fig. 6 from Melvin et al., 2013

Phenotype of all Fish created by or utilizing MO2-tshz2

Phenotype	Fish	Conditions	Figures
ceratohyal cartilage flattened, abnormal	WT + MO2-tshz2	standard conditions	Fig. 6 from Melvin et al., 2013
ceratohyal cartilage inverted, abnormal	WT + MO2-tshz2	standard conditions	Fig. 6 from Melvin et al., 2013
ceratobranchial cartilage absent, abnormal	WT + MO2-tshz2	standard conditions	Fig. 6 from Melvin et al., 2013
Meckel's cartilage malformed, abnormal	WT + MO2-tshz2	standard conditions	Fig. 6 from Melvin et al., 2013
hyosymplectic cartilage malformed, abnormal	WT + MO2-tshz2	standard conditions	Fig. 6 from Melvin et al., 2013
cranial cartilage absent, abnormal	WT + MO2-tshz2	standard conditions	Fig. 6 from Melvin et al., 2013
ethmoid cartilage decreased size, abnormal	WT + MO2-tshz2	standard conditions	Fig. 6 from Melvin et al., 2013
head anterior side collapsed, abnormal	WT + MO2-tshz2	standard conditions	Fig. 6 from Melvin et al., 2013
palatoquadrate cartilage malformed, abnormal	WT + MO2-tshz2	standard conditions	Fig. 6 from Melvin et al., 2013
ethmoid cartilage absent, abnormal	WT + MO2-tshz2	standard conditions	Fig. 6 from Melvin et al., 2013
neurocranial trabecula fused with neurocranial trabecula, abnormal	WT + MO2-tshz2	standard conditions	Fig. 6 from Melvin et al., 2013

Citations