Morpholino

MO1-slc16a2

ID

ZDB-MRPHLNO-130409-1

Name

MO1-slc16a2

Previous Names

Target

Sequence

5' - ATAAAATCATGTATTTACGTGGCGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-slc16a2

Expressed Gene	Anatomy	Figures
bdnf	whole organism	Fig. 9 from Walter et al., 2018
dio1	whole organism	Fig. 4 from Vatine et al., 2013
dio2	whole organism	Fig. 9 from Walter et al., 2018 Fig. 4 from Vatine et al., 2013
dio3b	whole organism	Fig. 9 from Walter et al., 2018 Fig. 4 from Vatine et al., 2013
klf9	whole organism	Fig. 9 from Walter et al., 2018
mag	whole organism	Fig. 9 from Walter et al., 2018
mbpa	whole organism	Fig. 9 from Walter et al., 2018
myod1	muscle	Fig. 6 from Vatine et al., 2013
shha	whole organism	Fig. 9 from Walter et al., 2018
slco1c1	whole organism	Fig. 9 from Walter et al., 2018
thraa	whole organism	Fig. 9 from Walter et al., 2018
thrab	whole organism	Fig. 9 from Walter et al., 2018
thrb	whole organism	Fig. 9 from Walter et al., 2018

Phenotype

Phenotype resulting from MO1-slc16a2

Phenotype	Fish	Figures
brain deformed, abnormal	biu2Tg + MO1-slc16a2	Fig. 5 from Vatine et al., 2013
central nervous system development disrupted, abnormal	biu1Tg; biu3Tg + MO1-slc16a2	Fig. 6 from Vatine et al., 2013
embryo development disrupted, abnormal	biu2Tg + MO1-slc16a2	Fig. 5 from Vatine et al., 2013
eye decreased size, abnormal	biu2Tg + MO1-slc16a2	Fig. 5 from Vatine et al., 2013
notochord deformed, abnormal	biu2Tg + MO1-slc16a2	Fig. 5 from Vatine et al., 2013
pericardium edematous, abnormal	biu2Tg + MO1-slc16a2	Fig. 5 from Vatine et al., 2013
spinal cord deformed, abnormal	biu2Tg + MO1-slc16a2	Fig. 5 from Vatine et al., 2013
trunk morphology, abnormal	biu2Tg + MO1-slc16a2	Fig. 5 from Vatine et al., 2013
whole organism decreased pigmentation, abnormal	biu2Tg + MO1-slc16a2	Fig. 5 from Vatine et al., 2013

Phenotype of all Fish created by or utilizing MO1-slc16a2

Phenotype	Fish	Conditions	Figures
whole organism dio3b expression decreased amount, abnormal	WT + MO1-slc16a2	chemical treatment by environment: 6-propyl-2-thiouracil	Fig. 9 from Walter et al., 2018
whole organism decreased pigmentation, abnormal	biu2Tg + MO1-slc16a2	standard conditions	Fig. 5 from Vatine et al., 2013
trunk morphology, abnormal	biu2Tg + MO1-slc16a2	standard conditions	Fig. 5 from Vatine et al., 2013
embryo development disrupted, abnormal	biu2Tg + MO1-slc16a2	standard conditions	Fig. 5 from Vatine et al., 2013
brain deformed, abnormal	biu2Tg + MO1-slc16a2	standard conditions	Fig. 5 from Vatine et al., 2013
spinal cord deformed, abnormal	biu2Tg + MO1-slc16a2	standard conditions	Fig. 5 from Vatine et al., 2013
eye decreased size, abnormal	biu2Tg + MO1-slc16a2	standard conditions	Fig. 5 from Vatine et al., 2013
notochord deformed, abnormal	biu2Tg + MO1-slc16a2	standard conditions	Fig. 5 from Vatine et al., 2013
pericardium edematous, abnormal	biu2Tg + MO1-slc16a2	standard conditions	Fig. 5 from Vatine et al., 2013
central nervous system development disrupted, abnormal	biu1Tg; biu3Tg + MO1-slc16a2	standard conditions	Fig. 6 from Vatine et al., 2013

Citations