Morpholino

MO1-ca8

ID
ZDB-MRPHLNO-130227-5
Name
MO1-ca8
Previous Names
  • CA8 antisense MO1 (1)
Target
Sequence
5' - CGTGGAGAGAAGATTGAGTTGCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ca8
No data available
Phenotype
Phenotype resulting from MO1-ca8
Phenotype Fish Figures
cerebellum decreased size, abnormal AB + MO1-ca8 Fig. 6 from Aspatwar et al., 2013
cerebellum morphology, abnormal AB + MO1-ca8 Fig. 6 from Aspatwar et al., 2013
embryo development disrupted, abnormal AB + MO1-ca8 Fig. 5 from Aspatwar et al., 2013
head morphology, abnormal AB + MO1-ca8 Fig. 5,  text only from Aspatwar et al., 2013
neuron apoptotic, abnormal AB + MO1-ca8 Fig. 6 from Aspatwar et al., 2013
pericardium edematous, abnormal AB + MO1-ca8 Fig. 5 from Aspatwar et al., 2013
post-vent region curved, abnormal AB + MO1-ca8 Fig. 5 from Aspatwar et al., 2013
post-vent region cell apoptotic, abnormal AB + MO1-ca8 Fig. 6 from Aspatwar et al., 2013
swim bladder agenesis, abnormal AB + MO1-ca8 Fig. 5 from Aspatwar et al., 2013
swimming behavior disrupted, abnormal AB + MO1-ca8 Fig. 7 from Aspatwar et al., 2013
whole organism dead, abnormal AB + MO1-ca8 Fig. 5 from Aspatwar et al., 2013
whole organism fragile, abnormal AB + MO1-ca8 Fig. 5 from Aspatwar et al., 2013
Phenotype of all Fish created by or utilizing MO1-ca8
Phenotype Fish Conditions Figures
swimming behavior disrupted, abnormal AB + MO1-ca8 standard conditions Fig. 7 from Aspatwar et al., 2013
post-vent region cell apoptotic, abnormal AB + MO1-ca8 standard conditions Fig. 6 from Aspatwar et al., 2013
head morphology, abnormal AB + MO1-ca8 standard conditions Fig. 5,  text only from Aspatwar et al., 2013
embryo development disrupted, abnormal AB + MO1-ca8 standard conditions Fig. 5 from Aspatwar et al., 2013
neuron apoptotic, abnormal AB + MO1-ca8 standard conditions Fig. 6 from Aspatwar et al., 2013
cerebellum decreased size, abnormal AB + MO1-ca8 standard conditions Fig. 6 from Aspatwar et al., 2013
post-vent region curved, abnormal AB + MO1-ca8 standard conditions Fig. 5 from Aspatwar et al., 2013
swim bladder agenesis, abnormal AB + MO1-ca8 standard conditions Fig. 5 from Aspatwar et al., 2013
whole organism fragile, abnormal AB + MO1-ca8 standard conditions Fig. 5 from Aspatwar et al., 2013
pericardium edematous, abnormal AB + MO1-ca8 standard conditions Fig. 5 from Aspatwar et al., 2013
whole organism dead, abnormal AB + MO1-ca8 standard conditions Fig. 5 from Aspatwar et al., 2013
cerebellum morphology, abnormal AB + MO1-ca8 standard conditions Fig. 6 from Aspatwar et al., 2013
whole organism dead, abnormal AB + MO1-ca8 + MO4-tp53 standard conditions Fig. 5 from Aspatwar et al., 2013
neuron apoptotic, abnormal AB + MO1-ca8 + MO4-tp53 standard conditions Fig. 6 from Aspatwar et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.