Morpholino

MO1-taok2b

ID

ZDB-MRPHLNO-121207-23

Name

MO1-taok2b

Previous Names

None

Target

taok2b (1)

Sequence

5' - CCATCCTGAAAACACAGCACAACTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-taok2b

No data available

Phenotype

Phenotype resulting from MO1-taok2b

Phenotype	Fish	Figures
brain morphology, abnormal	WT + MO1-taok2b	Fig. 2 from Blaker-Lee et al., 2012
post-vent region decreased length, abnormal	WT + MO1-taok2b	Fig. 3 from Blaker-Lee et al., 2012
post-vent region shape, abnormal	WT + MO1-taok2b	Fig. 3 from Blaker-Lee et al., 2012
somite U-shaped, abnormal	WT + MO1-taok2b	Fig. 3 from Blaker-Lee et al., 2012
ventricular system decreased size, abnormal	WT + MO1-taok2b	Fig. 2 from Blaker-Lee et al., 2012

Phenotype of all Fish created by or utilizing MO1-taok2b

Phenotype	Fish	Conditions	Figures
post-vent region shape, abnormal	WT + MO1-taok2b	standard conditions	Fig. 3 from Blaker-Lee et al., 2012
brain morphology, abnormal	WT + MO1-taok2b	standard conditions	Fig. 2 from Blaker-Lee et al., 2012
post-vent region decreased length, abnormal	WT + MO1-taok2b	standard conditions	Fig. 3 from Blaker-Lee et al., 2012
somite U-shaped, abnormal	WT + MO1-taok2b	standard conditions	Fig. 3 from Blaker-Lee et al., 2012
ventricular system decreased size, abnormal	WT + MO1-taok2b	standard conditions	Fig. 2 from Blaker-Lee et al., 2012
ventricular system morphology, abnormal	AB + MO1-kif22 + MO1-taok2b + MO4-tp53	standard conditions	Fig. S1 , Table S2 from McCammon et al., 2017
skeletal muscle cell disorganized, abnormal	AB + MO1-kif22 + MO1-taok2b + MO4-tp53	standard conditions	Fig. S3 , Table S2 from McCammon et al., 2017
enteric neuron decreased amount, abnormal	AB + MO1-kif22 + MO1-taok2b + MO4-tp53	standard conditions	Table S2 from McCammon et al., 2017
brain morphology, abnormal	AB + MO1-kif22 + MO1-taok2b + MO4-tp53	standard conditions	Fig. S1 , Table S2 from McCammon et al., 2017
skeletal muscle cell morphology, abnormal	AB + MO1-kif22 + MO1-taok2b + MO4-tp53	standard conditions	Fig. S3 , Table S2 from McCammon et al., 2017
brain morphology, abnormal	AB + MO1-sez6l2 + MO1-taok2b + MO4-tp53	standard conditions	Table S2 from McCammon et al., 2017
ventricular system morphology, abnormal	AB + MO1-sez6l2 + MO1-taok2b + MO4-tp53	standard conditions	Table S2 from McCammon et al., 2017
skeletal muscle cell disorganized, abnormal	AB + MO1-sez6l2 + MO1-taok2b + MO4-tp53	standard conditions	Table S2 from McCammon et al., 2017
enteric neuron decreased amount, abnormal	AB + MO1-sez6l2 + MO1-taok2b + MO4-tp53	standard conditions	Fig. S3 , Table S2 from McCammon et al., 2017
skeletal muscle cell morphology, abnormal	AB + MO1-sez6l2 + MO1-taok2b + MO4-tp53	standard conditions	Table S2 from McCammon et al., 2017
central nervous system neuron differentiation process quality, abnormal	nl1Tg + MO1-kif22 + MO1-taok2b + MO4-tp53	standard conditions	Table S2 from McCammon et al., 2017
central nervous system neuron differentiation process quality, abnormal	nl1Tg + MO1-sez6l2 + MO1-taok2b + MO4-tp53	standard conditions	Table S2 from McCammon et al., 2017
cranial nerve development process quality, abnormal	rw0Tg + MO1-kif22 + MO1-taok2b + MO4-tp53	standard conditions	Table S2 from McCammon et al., 2017

Citations