Morpholino

MO5-ppp4ca

ID
ZDB-MRPHLNO-121207-19
Name
MO5-ppp4ca
Previous Names
None
Target
Sequence
5' - GTGGAGTAAAAGGAGTTACCTTGCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-ppp4ca
No data available
Phenotype
Phenotype resulting from MO5-ppp4ca
Phenotype Fish Figures
brain morphology, abnormal WT + MO5-ppp4ca Fig. 2 with image from Blaker-Lee et al., 2012
central nervous system projection neuron axonogenesis disrupted, abnormal WT + MO5-ppp4ca Fig. 3 with image from Blaker-Lee et al., 2012
forebrain axon decreased size, abnormal WT + MO5-ppp4ca Fig. 5 with image from Blaker-Lee et al., 2012
forebrain axon disorganized, abnormal WT + MO5-ppp4ca Fig. 5 with image from Blaker-Lee et al., 2012
hindbrain axon decreased length, abnormal WT + MO5-ppp4ca Fig. 5 with image from Blaker-Lee et al., 2012
hindbrain axon disorganized, abnormal WT + MO5-ppp4ca Fig. 5 with image from Blaker-Lee et al., 2012
midbrain shape, abnormal WT + MO5-ppp4ca Fig. 2 with image from Blaker-Lee et al., 2012
pigment cell decreased amount, abnormal WT + MO5-ppp4ca Fig. S3 with image from Blaker-Lee et al., 2012
post-vent region decreased length, abnormal WT + MO5-ppp4ca Fig. 3 with image from Blaker-Lee et al., 2012
post-vent region shape, abnormal WT + MO5-ppp4ca Fig. 3 with image from Blaker-Lee et al., 2012
somite U-shaped, abnormal WT + MO5-ppp4ca Fig. 3 with image from Blaker-Lee et al., 2012
thigmotaxis decreased process quality, abnormal WT + MO5-ppp4ca Fig. 3 with image from Blaker-Lee et al., 2012
Phenotype of all Fish created by or utilizing MO5-ppp4ca
Phenotype Fish Conditions Figures
brain morphology, abnormal WT + MO5-ppp4ca standard conditions Fig. 2 with image from Blaker-Lee et al., 2012
pigment cell decreased amount, abnormal WT + MO5-ppp4ca standard conditions Fig. S3 with image from Blaker-Lee et al., 2012
midbrain shape, abnormal WT + MO5-ppp4ca standard conditions Fig. 2 with image from Blaker-Lee et al., 2012
post-vent region shape, abnormal WT + MO5-ppp4ca standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
post-vent region decreased length, abnormal WT + MO5-ppp4ca standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
thigmotaxis decreased process quality, abnormal WT + MO5-ppp4ca standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
central nervous system projection neuron axonogenesis disrupted, abnormal WT + MO5-ppp4ca standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
forebrain axon decreased size, abnormal WT + MO5-ppp4ca standard conditions Fig. 5 with image from Blaker-Lee et al., 2012
forebrain axon disorganized, abnormal WT + MO5-ppp4ca standard conditions Fig. 5 with image from Blaker-Lee et al., 2012
somite U-shaped, abnormal WT + MO5-ppp4ca standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
hindbrain axon decreased length, abnormal WT + MO5-ppp4ca standard conditions Fig. 5 with image from Blaker-Lee et al., 2012
hindbrain axon disorganized, abnormal WT + MO5-ppp4ca standard conditions Fig. 5 with image from Blaker-Lee et al., 2012
skeletal muscle cell disorganized, abnormal AB + MO1-asphd1 + MO4-tp53 + MO5-ppp4ca standard conditions Table S2 from McCammon et al., 2017
skeletal muscle cell morphology, abnormal AB + MO1-asphd1 + MO4-tp53 + MO5-ppp4ca standard conditions Table S2 from McCammon et al., 2017
ventricular system morphology, abnormal AB + MO1-asphd1 + MO4-tp53 + MO5-ppp4ca standard conditions Table S2 from McCammon et al., 2017
enteric neuron decreased amount, abnormal AB + MO1-asphd1 + MO4-tp53 + MO5-ppp4ca standard conditions Table S2 from McCammon et al., 2017
brain morphology, abnormal AB + MO1-asphd1 + MO4-tp53 + MO5-ppp4ca standard conditions Table S2 from McCammon et al., 2017
ventricular system morphology, abnormal AB + MO2-kctd13 + MO4-tp53 + MO5-ppp4ca standard conditions Table S2 from McCammon et al., 2017
enteric neuron decreased amount, abnormal AB + MO2-kctd13 + MO4-tp53 + MO5-ppp4ca standard conditions Table S2 from McCammon et al., 2017
brain morphology, abnormal AB + MO2-kctd13 + MO4-tp53 + MO5-ppp4ca standard conditions Table S2 from McCammon et al., 2017
cranial nerve development process quality, abnormal rw0Tg + MO2-kctd13 + MO4-tp53 + MO5-ppp4ca standard conditions Table S2 from McCammon et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.