Morpholino

MO1-aldoaa

ID

ZDB-MRPHLNO-121207-1

Name

MO1-aldoaa

Previous Names

None

Target

aldoaa (1)

Sequence

5' - CCATGCTGAGGAGGAATGCAAGATT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-aldoaa

No data available

Phenotype

Phenotype resulting from MO1-aldoaa

Phenotype	Fish	Figures
brain morphology, abnormal	WT + MO1-aldoaa	Fig. 2 from Blaker-Lee et al., 2012
forebrain decreased width, abnormal	WT + MO1-aldoaa	Fig. 2 from Blaker-Lee et al., 2012
midbrain shape, abnormal	WT + MO1-aldoaa	Fig. 2 from Blaker-Lee et al., 2012
pigment cell decreased amount, abnormal	WT + MO1-aldoaa	Fig. S3 from Blaker-Lee et al., 2012
post-vent region decreased length, abnormal	WT + MO1-aldoaa	Fig. 3 from Blaker-Lee et al., 2012
post-vent region shape, abnormal	WT + MO1-aldoaa	Fig. 3 from Blaker-Lee et al., 2012
somite U-shaped, abnormal	WT + MO1-aldoaa	Fig. 6 from Blaker-Lee et al., 2012
somite contractile muscle fiber disorganized, abnormal	WT + MO1-aldoaa	Fig. 6 from Blaker-Lee et al., 2012
somite contractile muscle fiber undulate, abnormal	WT + MO1-aldoaa	Fig. 6 from Blaker-Lee et al., 2012
thigmotaxis decreased process quality, abnormal	WT + MO1-aldoaa	Fig. 3 from Blaker-Lee et al., 2012
whole organism pigmented, abnormal	WT + MO1-aldoaa	Fig. 3 from Blaker-Lee et al., 2012

Phenotype of all Fish created by or utilizing MO1-aldoaa

Phenotype	Fish	Conditions	Figures
thigmotaxis decreased process quality, abnormal	WT + MO1-aldoaa	standard conditions	Fig. 3 from Blaker-Lee et al., 2012
whole organism pigmented, abnormal	WT + MO1-aldoaa	standard conditions	Fig. 3 from Blaker-Lee et al., 2012
somite U-shaped, abnormal	WT + MO1-aldoaa	standard conditions	Fig. 6 from Blaker-Lee et al., 2012
pigment cell decreased amount, abnormal	WT + MO1-aldoaa	standard conditions	Fig. S3 from Blaker-Lee et al., 2012
post-vent region decreased length, abnormal	WT + MO1-aldoaa	standard conditions	Fig. 3 from Blaker-Lee et al., 2012
somite contractile muscle fiber disorganized, abnormal	WT + MO1-aldoaa	standard conditions	Fig. 6 from Blaker-Lee et al., 2012
brain morphology, abnormal	WT + MO1-aldoaa	standard conditions	Fig. 2 from Blaker-Lee et al., 2012
somite contractile muscle fiber undulate, abnormal	WT + MO1-aldoaa	standard conditions	Fig. 6 from Blaker-Lee et al., 2012
forebrain decreased width, abnormal	WT + MO1-aldoaa	standard conditions	Fig. 2 from Blaker-Lee et al., 2012
midbrain shape, abnormal	WT + MO1-aldoaa	standard conditions	Fig. 2 from Blaker-Lee et al., 2012
post-vent region shape, abnormal	WT + MO1-aldoaa	standard conditions	Fig. 3 from Blaker-Lee et al., 2012
ventricular system morphology, abnormal	AB + MO1-aldoaa + MO1-tlcd3ba	standard conditions	Table S2 from McCammon et al., 2017
brain morphology, abnormal	AB + MO1-aldoaa + MO1-tlcd3ba	standard conditions	Table S2 from McCammon et al., 2017
cranial nerve development process quality, abnormal	rw0Tg + MO1-aldoaa + MO1-tlcd3ba	standard conditions	Table S2 from McCammon et al., 2017

Citations