Morpholino

MO1-atg5

ID
ZDB-MRPHLNO-121010-2
Name
MO1-atg5
Previous Names
  • 5MOatg5 (1)
Target
Sequence
5' - CATCCTTGTCATCTGCCATTATCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-atg5
Expressed Gene Anatomy Figures
atg5 Fig. 4 from Hu et al., 2011
atg12 Fig. 4 from Hu et al., 2011
elavl3 Fig. 5 from Hu et al., 2011
gli1 Fig. 5 from Hu et al., 2011
map1lc3b Fig. 6 with image from Boglev et al., 2013
necab1 Fig. 5 from Hu et al., 2011
neurog1 Fig. 5 from Hu et al., 2011
nkx2.2a Fig. 5 from Hu et al., 2011
park7 Fig. 5 from Hu et al., 2011
pink1 Fig. 5 from Hu et al., 2011
slc6a3 Fig. 6 from Hu et al., 2017
sncb Fig. 5 from Hu et al., 2011
th Fig. 4,  Fig. 5 from Hu et al., 2017
uchl1 Fig. 5 from Hu et al., 2011
zic1 Fig. 5 from Hu et al., 2011
Phenotype
Phenotype resulting from MO1-atg5
Phenotype Fish Figures
blood decreased volume, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
common cardinal vein congested, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
diencephalon dopaminergic neuron decreased amount, abnormal AB + MO1-atg5 Fig. 5,  Fig. 6 from Hu et al., 2017
dopaminergic neuron decreased amount, abnormal AB + MO1-atg5 Fig. 4 from Hu et al., 2017
embryo development disrupted, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
extension decreased length, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
eye decreased size, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
eye hypoplastic, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
eye development disrupted, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
head decreased size, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
head hypoplastic, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
heart structure, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
otolith decreased amount, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
post-vent region decreased length, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
somite structure, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
swimming decreased process quality, abnormal AB + MO1-atg5 Fig. 7 from Hu et al., 2017
trunk decreased length, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
whole organism dead, abnormal WT + MO1-atg5 Fig. 2 from Mans et al., 2017
whole organism ab1-atg5 labeling decreased amount, abnormal AB + MO1-atg5 Fig. 3 from Hu et al., 2017
whole organism ab3-map1lc3b labeling decreased amount, abnormal AB + MO1-atg5 Figure 5 with image from Inoue et al., 2021
whole organism Ab5-map1lc3b labeling decreased amount, abnormal AB + MO1-atg5 Fig. 3 from Hu et al., 2017
whole organism ab3-th labeling decreased amount, abnormal AB + MO1-atg5 Fig. 3 from Hu et al., 2017
whole organism decreased life span, abnormal WT + MO1-atg5 Fig. 2 from Mans et al., 2017
whole organism Ab1-park8 labeling increased amount, abnormal AB + MO1-atg5 Fig. 3 from Hu et al., 2017
whole organism ab4-sqstm1 labeling increased amount, abnormal AB + MO1-atg5 Fig. 3 from Hu et al., 2017
whole organism Ab2-pink1 labeling increased amount, abnormal AB + MO1-atg5 Fig. 3 from Hu et al., 2017
whole organism ab2-sncb labeling increased amount, abnormal AB + MO1-atg5 Fig. 3 from Hu et al., 2017
whole organism morphology, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
whole organism viability, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
yolk vacuolated, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
Phenotype of all Fish created by or utilizing MO1-atg5
Phenotype Fish Conditions Figures
diencephalon dopaminergic neuron decreased amount, abnormal AB + MO1-atg5 control Fig. 5,  Fig. 6 from Hu et al., 2017
whole organism ab3-map1lc3b labeling decreased amount, abnormal AB + MO1-atg5 control Figure 5 with image from Inoue et al., 2021
dopaminergic neuron decreased amount, exacerbated AB + MO1-atg5 chemical treatment by environment: 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine Fig. 4 from Hu et al., 2017
swimming decreased process quality, exacerbated AB + MO1-atg5 chemical treatment by environment: 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine Fig. 7 from Hu et al., 2017
whole organism ab1-atg5 labeling decreased amount, abnormal AB + MO1-atg5 control Fig. 3 from Hu et al., 2017
whole organism Ab1-park8 labeling increased amount, abnormal AB + MO1-atg5 control Fig. 3 from Hu et al., 2017
swimming decreased process quality, abnormal AB + MO1-atg5 control Fig. 7 from Hu et al., 2017
whole organism ab3-th labeling decreased amount, abnormal AB + MO1-atg5 control Fig. 3 from Hu et al., 2017
whole organism Ab5-map1lc3b labeling decreased amount, abnormal AB + MO1-atg5 control Fig. 3 from Hu et al., 2017
dopaminergic neuron decreased amount, abnormal AB + MO1-atg5 control Fig. 4 from Hu et al., 2017
diencephalon dopaminergic neuron decreased amount, exacerbated AB + MO1-atg5 chemical treatment by environment: 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine Fig. 5,  Fig. 6 from Hu et al., 2017
whole organism ab2-sncb labeling increased amount, abnormal AB + MO1-atg5 control Fig. 3 from Hu et al., 2017
whole organism Ab2-pink1 labeling increased amount, abnormal AB + MO1-atg5 control Fig. 3 from Hu et al., 2017
whole organism ab4-sqstm1 labeling increased amount, abnormal AB + MO1-atg5 control Fig. 3 from Hu et al., 2017
whole organism decreased life span, exacerbated AB/TL + MO1-atg5 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 5 with image from Masud et al., 2019
post-vent region decreased length, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
extension decreased length, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
eye decreased size, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
trunk decreased length, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
heart structure, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
eye development disrupted, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
common cardinal vein congested, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
yolk vacuolated, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
somite structure, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
blood decreased volume, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
eye hypoplastic, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
otolith decreased amount, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
whole organism viability, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
head hypoplastic, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
whole organism morphology, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
head decreased size, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
embryo development disrupted, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
lateral rectus regenerating tissue decreased length, abnormal WT + MO1-atg5 resection: lateral rectus Fig. 3 with image from Saera-Vila et al., 2016
lateral rectus skeletal muscle tissue regeneration decreased process quality, abnormal WT + MO1-atg5 resection: lateral rectus Fig. 3 with image from Saera-Vila et al., 2016
whole organism dead, abnormal WT + MO1-atg5 standard conditions Fig. 2 from Mans et al., 2017
whole organism decreased life span, abnormal WT + MO1-atg5 standard conditions Fig. 2 from Mans et al., 2017
swim bladder inflated, ameliorated lars1boi3/oi3 + MO1-atg5 (AB) control Figure 5 with image from Inoue et al., 2021
pericardium morphology, ameliorated lars1boi3/oi3 + MO1-atg5 (AB) control Figure 5 with image from Inoue et al., 2021
intestine cell hypotrophic, abnormal pwp2hs450/s450 + MO1-atg5 standard conditions Fig. 6 with image from Boglev et al., 2013
whole organism dead, abnormal pwp2hs450/s450 + MO1-atg5 standard conditions Fig. 6 with image from Boglev et al., 2013
intestine edematous, abnormal pwp2hs450/s450 + MO1-atg5 standard conditions Fig. S7 with image from Boglev et al., 2013
heart edematous, abnormal pwp2hs450/s450 + MO1-atg5 standard conditions Fig. S7 with image from Boglev et al., 2013
intestinal epithelium cell detached from intestine, abnormal pwp2hs450/s450 + MO1-atg5 standard conditions Fig. 6 with image from Boglev et al., 2013
eye edematous, abnormal pwp2hs450/s450 + MO1-atg5 standard conditions Fig. S7 with image from Boglev et al., 2013
head edematous, abnormal pwp2hs450/s450 + MO1-atg5 standard conditions Fig. S7 with image from Boglev et al., 2013
whole organism decreased life span, abnormal stk11hu1968/hu1968 + MO1-atg5 standard conditions Fig. 2 from Mans et al., 2017
whole organism dead, abnormal stk11hu1968/hu1968 + MO1-atg5 standard conditions Fig. 2 from Mans et al., 2017
lateral rectus regenerating tissue EGFP expression decreased amount, abnormal zf155Tg + MO1-atg5 resection: lateral rectus Fig. 3 with image from Saera-Vila et al., 2016
autophagy disrupted, abnormal zf155Tg + MO1-atg5 resection: lateral rectus Fig. 3 with image from Saera-Vila et al., 2016
liver size, ameliorated lars1boi3/oi3; oi2Tg + MO1-atg5 (AB) control Figure 5 with image from Inoue et al., 2021
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.