Morpholino

MO1-snai2

ID
ZDB-MRPHLNO-121002-2
Name
MO1-snai2
Previous Names
None
Target
Sequence
5' - ATACATGTCATTTTCTCACCCGTGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-snai2
Expressed Gene Anatomy Figures
dlc Fig. 5 with image from Bickers et al., 2018
dld Fig. 5 with image from Bickers et al., 2018
foxc1b Fig. 4 with image from Bickers et al., 2018
myod1 Fig. 4 with image from Bickers et al., 2018
pax9 Fig. 4 with image from Bickers et al., 2018
runx1 Fig. 3 with image,  Fig. 5 with image,  Fig. 9 with image from Bickers et al., 2018
twist1b Fig. 4 with image from Bickers et al., 2018
Phenotype
Phenotype resulting from MO1-snai2
Phenotype Fish Figures
dorsal aorta EGFP expression decreased amount, abnormal um14Tg + MO1-snai2 Fig. 5 with image from Bickers et al., 2018
sclerotome pax9 expression decreased amount, abnormal AB + MO1-snai2 Fig. 4 with image from Bickers et al., 2018
sclerotome foxc1b expression decreased amount, abnormal AB + MO1-snai2 Fig. 4 with image from Bickers et al., 2018
somite twist1b expression decreased amount, abnormal zf13Tg + MO1-snai2 Fig. 4 with image from Bickers et al., 2018
somite dlc expression decreased amount, abnormal AB + MO1-snai2 Fig. 5 with image from Bickers et al., 2018
somite dld expression decreased amount, abnormal AB + MO1-snai2 Fig. 5 with image from Bickers et al., 2018
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal hzm3Tg; s896Tg; sd32Tg + MO1-snai2 Fig. 3 with image,  Fig. 9 with image from Bickers et al., 2018
ventral wall of dorsal aorta hematopoietic stem cell runx1 expression decreased amount, abnormal WT + MO1-snai2 Fig. 3 with image,  Fig. 5 with image,  Fig. 9 with image from Bickers et al., 2018
Phenotype of all Fish created by or utilizing MO1-snai2
Phenotype Fish Conditions Figures
ventral wall of dorsal aorta hematopoietic stem cell runx1 expression decreased amount, abnormal snai2sd57/sd57 + MO1-snai2 standard conditions Fig. 9 with image from Bickers et al., 2018
sclerotome foxc1b expression decreased amount, abnormal AB + MO1-snai2 standard conditions Fig. 4 with image from Bickers et al., 2018
sclerotome pax9 expression decreased amount, abnormal AB + MO1-snai2 standard conditions Fig. 4 with image from Bickers et al., 2018
somite dlc expression decreased amount, abnormal AB + MO1-snai2 standard conditions Fig. 5 with image from Bickers et al., 2018
somite dld expression decreased amount, abnormal AB + MO1-snai2 standard conditions Fig. 5 with image from Bickers et al., 2018
ventral wall of dorsal aorta hematopoietic stem cell runx1 expression decreased amount, abnormal AB + MO1-snai2 standard conditions Fig. 3 with image,  Fig. 5 with image from Bickers et al., 2018
ventral wall of dorsal aorta hematopoietic stem cell runx1 expression decreased amount, abnormal WT + MO1-snai2 standard conditions Fig. 9 with image from Bickers et al., 2018
ventral wall of dorsal aorta hematopoietic stem cell runx1 expression decreased amount, abnormal snai2sd57/+ + MO1-snai2 standard conditions Fig. 9 with image from Bickers et al., 2018
dorsal aorta EGFP expression decreased amount, abnormal um14Tg + MO1-snai2 standard conditions Fig. 5 with image from Bickers et al., 2018
somite dlc expression decreased amount, abnormal zf13Tg + MO1-snai2 standard conditions Fig. 5 with image from Bickers et al., 2018
somite twist1b expression decreased amount, abnormal zf13Tg + MO1-snai2 standard conditions Fig. 4 with image from Bickers et al., 2018
somite dld expression decreased amount, abnormal zf13Tg + MO1-snai2 standard conditions Fig. 5 with image from Bickers et al., 2018
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal hzm3Tg; s896Tg; sd32Tg + MO1-snai2 standard conditions Fig. 3 with image,  Fig. 9 with image from Bickers et al., 2018
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal snai2sd57/+; hzm3Tg; s896Tg; sd32Tg + MO1-snai2 standard conditions Fig. 9 with image from Bickers et al., 2018
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal snai2sd57/sd57; hzm3Tg; s896Tg; sd32Tg + MO1-snai2 standard conditions Fig. 9 with image from Bickers et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.