Morpholino

MO2-smyd2a

ID

ZDB-MRPHLNO-120824-2

Name

MO2-smyd2a

Previous Names

splice donor site of intron 4 (1)

Target

smyd2a (1)

Sequence

5' - AATCATCTAGACACTTACGTGCTTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-smyd2a

No data available

Phenotype

Phenotype resulting from MO2-smyd2a

Phenotype	Fish	Figures
atrium malformed, abnormal	WT + MO2-smyd2a	Fig. 5, text only from Voelkel et al., 2013
cardiac ventricle malformed, abnormal	WT + MO2-smyd2a	Fig. 5, text only from Voelkel et al., 2013
heart decreased contractility, abnormal	WT + MO2-smyd2a	Fig. 5 from Voelkel et al., 2013
heart decreased functionality, abnormal	WT + MO2-smyd2a	Fig. 5 from Voelkel et al., 2013
heart decreased thickness, abnormal	WT + MO2-smyd2a	text only from Voelkel et al., 2013
heart elongated, abnormal	WT + MO2-smyd2a	text only from Voelkel et al., 2013 Fig. 5 from Donlin et al., 2012
heart contraction decreased rate, abnormal	WT + MO2-smyd2a	text only from Voelkel et al., 2013 text only from Donlin et al., 2012
heart development disrupted, abnormal	WT + MO2-smyd2a	Fig. 5 from Donlin et al., 2012
pericardium edematous, abnormal	WT + MO2-smyd2a	text only from Voelkel et al., 2013 Fig. 5 from Donlin et al., 2012
post-vent region increased curvature, abnormal	WT + MO2-smyd2a	Fig. 5 from Donlin et al., 2012
sarcomere organization disrupted, abnormal	WT + MO2-smyd2a	Fig. 5 from Donlin et al., 2012
sinus venosus edematous, abnormal	WT + MO2-smyd2a	text only from Voelkel et al., 2013 Fig. 5 from Donlin et al., 2012
skeletal muscle morphology, abnormal	WT + MO2-smyd2a	text only from Voelkel et al., 2013
skeletal muscle cell disorganized, abnormal	WT + MO2-smyd2a	Fig. 5 from Donlin et al., 2012
skeletal muscle cell I band disorganized, abnormal	WT + MO2-smyd2a	Fig. 5 from Donlin et al., 2012
skeletal muscle cell sarcomere disorganized, abnormal	WT + MO2-smyd2a	Fig. 5 from Donlin et al., 2012
skeletal muscle cell Z disc disorganized, abnormal	WT + MO2-smyd2a	Fig. 5 from Donlin et al., 2012
skeletal muscle tissue development disrupted, abnormal	WT + MO2-smyd2a	Fig. 5 from Donlin et al., 2012
whole organism decreased mobility, abnormal	WT + MO2-smyd2a	text only from Donlin et al., 2012

Phenotype of all Fish created by or utilizing MO2-smyd2a

Phenotype	Fish	Conditions	Figures
heart development disrupted, abnormal	WT + MO2-smyd2a	standard conditions	Fig. 5 from Donlin et al., 2012
cardiac ventricle malformed, abnormal	WT + MO2-smyd2a	standard conditions	Fig. 5, text only from Voelkel et al., 2013
skeletal muscle cell Z disc disorganized, abnormal	WT + MO2-smyd2a	standard conditions	Fig. 5 from Donlin et al., 2012
heart decreased functionality, abnormal	WT + MO2-smyd2a	standard conditions	Fig. 5 from Voelkel et al., 2013
skeletal muscle cell I band disorganized, abnormal	WT + MO2-smyd2a	standard conditions	Fig. 5 from Donlin et al., 2012
sarcomere organization disrupted, abnormal	WT + MO2-smyd2a	standard conditions	Fig. 5 from Donlin et al., 2012
atrium malformed, abnormal	WT + MO2-smyd2a	standard conditions	Fig. 5, text only from Voelkel et al., 2013
skeletal muscle morphology, abnormal	WT + MO2-smyd2a	standard conditions	text only from Voelkel et al., 2013
post-vent region increased curvature, abnormal	WT + MO2-smyd2a	standard conditions	Fig. 5 from Donlin et al., 2012
heart contraction decreased rate, abnormal	WT + MO2-smyd2a	standard conditions	text only from Voelkel et al., 2013 text only from Donlin et al., 2012
skeletal muscle cell sarcomere disorganized, abnormal	WT + MO2-smyd2a	standard conditions	Fig. 5 from Donlin et al., 2012
skeletal muscle tissue development disrupted, abnormal	WT + MO2-smyd2a	standard conditions	Fig. 5 from Donlin et al., 2012
whole organism decreased mobility, abnormal	WT + MO2-smyd2a	standard conditions	text only from Donlin et al., 2012
skeletal muscle cell disorganized, abnormal	WT + MO2-smyd2a	standard conditions	Fig. 5 from Donlin et al., 2012
pericardium edematous, abnormal	WT + MO2-smyd2a	standard conditions	text only from Voelkel et al., 2013 Fig. 5 from Donlin et al., 2012
heart decreased contractility, abnormal	WT + MO2-smyd2a	standard conditions	Fig. 5 from Voelkel et al., 2013
heart decreased thickness, abnormal	WT + MO2-smyd2a	standard conditions	text only from Voelkel et al., 2013
heart elongated, abnormal	WT + MO2-smyd2a	standard conditions	text only from Voelkel et al., 2013 Fig. 5 from Donlin et al., 2012
sinus venosus edematous, abnormal	WT + MO2-smyd2a	standard conditions	text only from Voelkel et al., 2013 Fig. 5 from Donlin et al., 2012
whole organism decreased mobility, abnormal	WT + MO1-smyd2b + MO2-smyd2a	standard conditions	text only from Donlin et al., 2012
heart decreased functionality, abnormal	WT + MO1-smyd2b + MO2-smyd2a	standard conditions	Fig. 5 from Voelkel et al., 2013
pericardium edematous, abnormal	WT + MO1-smyd2b + MO2-smyd2a	standard conditions	Fig. 5 from Donlin et al., 2012
post-vent region increased curvature, abnormal	WT + MO1-smyd2b + MO2-smyd2a	standard conditions	Fig. 5 from Donlin et al., 2012
atrium malformed, abnormal	WT + MO1-smyd2b + MO2-smyd2a	standard conditions	Fig. 5 from Voelkel et al., 2013
peptidyl-lysine methylation decreased occurrence, abnormal	WT + MO1-smyd2b + MO2-smyd2a	standard conditions	Fig. 5 from Donlin et al., 2012
skeletal muscle morphology, abnormal	WT + MO1-smyd2b + MO2-smyd2a	standard conditions	text only from Voelkel et al., 2013
heart contraction decreased rate, abnormal	WT + MO1-smyd2b + MO2-smyd2a	standard conditions	text only from Donlin et al., 2012
heart decreased contractility, abnormal	WT + MO1-smyd2b + MO2-smyd2a	standard conditions	Fig. 5 from Voelkel et al., 2013
cardiac ventricle malformed, abnormal	WT + MO1-smyd2b + MO2-smyd2a	standard conditions	Fig. 5 from Voelkel et al., 2013
heart elongated, abnormal	WT + MO1-smyd2b + MO2-smyd2a	standard conditions	Fig. 5 from Donlin et al., 2012
sinus venosus edematous, abnormal	WT + MO1-smyd2b + MO2-smyd2a	standard conditions	Fig. 5 from Donlin et al., 2012

Citations