Morpholino

MO3-twist3

ID

ZDB-MRPHLNO-111209-9

Name

MO3-twist3

Previous Names

twist3 atgMO (1)

Target

twist3 (1)

Sequence

5' - TCCACAAGTCTGTTCCTCTCGCATG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-twist3

No data available

Phenotype

Phenotype resulting from MO3-twist3

Phenotype	Fish	Figures
eye decreased size, abnormal	zf13Tg + MO3-twist3	Fig. S2 from Zhao et al., 2020
eye protruding, abnormal	zf13Tg + MO3-twist3	Fig. S2 from Zhao et al., 2020
pericardium edematous, abnormal	zf13Tg + MO3-twist3	Fig. S2 from Zhao et al., 2020
post-vent region morphology, abnormal	zf13Tg + MO3-twist3	Fig. S2 from Zhao et al., 2020
trunk morphology, abnormal	zf13Tg + MO3-twist3	Fig. S2 from Zhao et al., 2020

Phenotype of all Fish created by or utilizing MO3-twist3

Phenotype	Fish	Conditions	Figures
lateral rectus regenerating tissue decreased size, abnormal	zf13Tg + MO3-twist3	resection: lateral rectus, chemical treatment by environment: SU5402	Fig. 4 from Zhao et al., 2020
trunk morphology, abnormal	zf13Tg + MO3-twist3	standard conditions	Fig. S2 from Zhao et al., 2020
skeletal muscle tissue regeneration disrupted, abnormal	zf13Tg + MO3-twist3	resection: lateral rectus	Fig. 1 , Fig. 4 from Zhao et al., 2020
lateral rectus regenerating tissue decreased size, abnormal	zf13Tg + MO3-twist3	resection: lateral rectus	Fig. 1 , Fig. 4 from Zhao et al., 2020
lateral rectus muscle cell proliferation decreased occurrence, abnormal	zf13Tg + MO3-twist3	resection: lateral rectus	Fig. 3 from Zhao et al., 2020
pericardium edematous, abnormal	zf13Tg + MO3-twist3	standard conditions	Fig. S2 from Zhao et al., 2020
post-vent region morphology, abnormal	zf13Tg + MO3-twist3	standard conditions	Fig. S2 from Zhao et al., 2020
lateral rectus regenerating tissue twist3 expression decreased amount, abnormal	zf13Tg + MO3-twist3	resection: lateral rectus	Fig. 3 from Zhao et al., 2020
eye decreased size, abnormal	zf13Tg + MO3-twist3	standard conditions	Fig. S2 from Zhao et al., 2020
eye protruding, abnormal	zf13Tg + MO3-twist3	standard conditions	Fig. S2 from Zhao et al., 2020
skeletal muscle tissue regeneration disrupted, abnormal	zf13Tg + MO3-twist3	resection: lateral rectus, chemical treatment by environment: SU5402	Fig. 4 from Zhao et al., 2020
lateral rectus regenerating tissue decreased size, abnormal	zf13Tg + MO2-twist1a + MO2-twist2 + MO3-twist3 + MO4-twist1b	resection: lateral rectus	Fig. 1 from Zhao et al., 2020
skeletal muscle tissue regeneration disrupted, abnormal	zf13Tg + MO2-twist1a + MO2-twist2 + MO3-twist3 + MO4-twist1b	resection: lateral rectus	Fig. 1 from Zhao et al., 2020

Citations